RNA id: TCONS_00012588


Basic Information

Item Value
RNA id TCONS_00012588
length 543
RNA type mRNA
GC content 0.48
exon number 5
gene id XLOC_006491
representative True

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 11963789 ~ 11971161 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TAGTAACCAGCGTCGGCGTCTCGAAAGGTACTTGCAGAAAGATGGGTTTATTGTCAATCCTTCGAAAACTAAAAAGTGCCCCAGACCAGGAGGTGCGCATTCTCCTCCTCGGCTTAGACAATGGTGGAAAGACGACACTTCTCAAACAGCTTGCTTCAGAGGATATTAGTCACATCACCCCAACGCAGGGCTTTAATATTAAGAGCGTTCAGTCTCAGGGCTTCAAACTGAATGTCTGGGACATAGGAGGCCAGAGGAAGATAAGGCCATACTGGAGAAACTACTTTGAAAATACTGACATGCTTATTTATGTTATAGACAGCGCAGACAGGAAGAGATTTGAGGAAACGGGACAGGAATTGGCTGAGCTGTTGGATGAGGAGAAACTTAGTGGTGTGCCTGTTTTAATTTTTGCGAATAAGCAAGACCTGCTGACCGCTGCTCCGGCCTCTGAGATCGCTGAGGGACTGAACCTGCACATCATCCGGGACAGAATGTGGCAAATTCAGTCCTGCTCTGCTCTTACAGGAGAGGGAGTCCAGG

Function

GO:

id name namespace
GO:0060271 cilium assembly biological_process
GO:0015630 microtubule cytoskeleton cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005525 GTP binding molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050417-368 Predicted to enable GTP binding activity. Predicted to be involved in cilium assembly. Predicted to be active in cytoplasm and microtubule cytoskeleton. Is expressed in neural tube; otic placode; and pronephric duct. Human ortholog(s) of this gene implicated in Joubert syndrome and retinitis pigmentosa 83. Orthologous to human ARL3 (ADP ribosylation factor like GTPase 3).

Ensembl:

ensembl_id ENSDART00000066230

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00013763 lncRNA downstream 520385 11442838 ~ 11445780 (-) True XLOC_006480
TCONS_00013762 lncRNA downstream 520775 11442838 ~ 11445390 (-) False XLOC_006480
TCONS_00013465 lncRNA downstream 587773 11353140 ~ 11378392 (-) False XLOC_006479
TCONS_00012570 lncRNA downstream 587810 11377446 ~ 11378355 (-) False XLOC_006479
TCONS_00012552 lncRNA downstream 1619285 10333719 ~ 10346880 (-) True XLOC_006472
TCONS_00013466 lncRNA upstream 145965 12117113 ~ 12118250 (-) True XLOC_006497
TCONS_00012599 lncRNA upstream 508120 12479268 ~ 12486058 (-) False XLOC_006499
TCONS_00012600 lncRNA upstream 508334 12479482 ~ 12486008 (-) False XLOC_006499
TCONS_00012602 lncRNA upstream 513199 12484347 ~ 12486050 (-) True XLOC_006499
TCONS_00013467 lncRNA upstream 615849 12586997 ~ 12587412 (-) True XLOC_006502
TCONS_00012585 mRNA downstream 165884 11767603 ~ 11800281 (-) True XLOC_006490
TCONS_00012583 mRNA downstream 202974 11746412 ~ 11763191 (-) False XLOC_006489
TCONS_00012584 mRNA downstream 202979 11746415 ~ 11763186 (-) True XLOC_006489
TCONS_00012582 mRNA downstream 222192 11714869 ~ 11743973 (-) False XLOC_006488
TCONS_00012590 mRNA upstream 4806 11975954 ~ 11986754 (-) False XLOC_006493
TCONS_00012591 mRNA upstream 5249 11976397 ~ 11984867 (-) True XLOC_006493
TCONS_00012592 mRNA upstream 17316 11988464 ~ 12005429 (-) False XLOC_006494
TCONS_00012593 mRNA upstream 17685 11988833 ~ 12006007 (-) True XLOC_006494
TCONS_00012594 mRNA upstream 36756 12007904 ~ 12021566 (-) True XLOC_006495
TCONS_00012573 other downstream 400302 11565736 ~ 11565863 (-) True XLOC_006482
TCONS_00012571 other downstream 587871 11378016 ~ 11378294 (-) True XLOC_006479
TCONS_00012566 other downstream 944059 11020274 ~ 11022106 (-) False XLOC_006478
TCONS_00012560 other downstream 1053563 10912486 ~ 10912602 (-) True XLOC_006476
TCONS_00012550 other downstream 1701260 10264741 ~ 10264905 (-) True XLOC_006471
TCONS_00012589 other upstream 3304 11974452 ~ 11974568 (-) True XLOC_006492
TCONS_00012595 other upstream 134630 12105778 ~ 12105894 (-) True XLOC_006496
TCONS_00012597 other upstream 407067 12378215 ~ 12389563 (-) True XLOC_006498
TCONS_00012601 other upstream 510230 12481378 ~ 12485992 (-) False XLOC_006499
TCONS_00012615 other upstream 1616148 13587296 ~ 13590570 (-) True XLOC_006510

Expression Profile

//