RNA id: TCONS_00013469


Basic Information

Item Value
RNA id TCONS_00013469
length 249
lncRNA type inter_gene
GC content 0.48
exon number 2
gene id XLOC_006525
representative True

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 15456676 ~ 15457624 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

aatcaaactgcagcagcacgccacgaggttttgctcagacttttgggacgtttggaattgctccgtcttgtcaccatgtaacacatagcagcaagacccatgggatttcatcagccactcaccatcagagtcctcagtggaagctgagaagagcagaagaggaagccaagcaagagatgccagaaaaaaagggggaaggaaataatgtgttattttgctgtttgagtataggcaggcgcagtgagtagc

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0050794 regulation of cellular process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko03070 Bacterial secretion system
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00013768 lncRNA downstream 475096 14950795 ~ 14981580 (-) True XLOC_006522
TCONS_00012627 lncRNA downstream 547707 14906407 ~ 14908969 (-) True XLOC_006520
TCONS_00013468 lncRNA downstream 923422 14532720 ~ 14533254 (-) True XLOC_006519
TCONS_00013767 lncRNA downstream 1441496 14013185 ~ 14015180 (-) True XLOC_006516
TCONS_00013766 lncRNA downstream 1716116 13737542 ~ 13740560 (-) True XLOC_006514
TCONS_00012632 lncRNA upstream 117513 15575137 ~ 15580152 (-) False XLOC_006526
TCONS_00013470 lncRNA upstream 118088 15575712 ~ 15578045 (-) True XLOC_006526
TCONS_00012638 lncRNA upstream 227869 15685493 ~ 15696991 (-) True XLOC_006527
TCONS_00013769 lncRNA upstream 803027 16260651 ~ 16261573 (-) True XLOC_006536
TCONS_00013770 lncRNA upstream 1410756 16868380 ~ 16879070 (-) True XLOC_006538
TCONS_00012631 mRNA downstream 314396 15091264 ~ 15142280 (-) True XLOC_006524
TCONS_00012630 mRNA downstream 374652 15020822 ~ 15082024 (-) True XLOC_006523
TCONS_00012628 mRNA downstream 527440 14915344 ~ 14929236 (-) False XLOC_006521
TCONS_00012629 mRNA downstream 530358 14922716 ~ 14926318 (-) True XLOC_006521
TCONS_00012625 mRNA downstream 547677 14902318 ~ 14908999 (-) False XLOC_006520
TCONS_00012633 mRNA upstream 224451 15682075 ~ 15700061 (-) False XLOC_006527
TCONS_00012634 mRNA upstream 224456 15682080 ~ 15700060 (-) False XLOC_006527
TCONS_00012635 mRNA upstream 225204 15682828 ~ 15702736 (-) False XLOC_006527
TCONS_00012636 mRNA upstream 227813 15685437 ~ 15700084 (-) False XLOC_006527
TCONS_00012637 mRNA upstream 227813 15685437 ~ 15702672 (-) False XLOC_006527
TCONS_00012624 other downstream 1072138 14384421 ~ 14384538 (-) True XLOC_006518
TCONS_00012619 other downstream 1786139 13670440 ~ 13670537 (-) True XLOC_006513
TCONS_00012616 other downstream 1812114 13644445 ~ 13644562 (-) True XLOC_006511
TCONS_00012615 other downstream 1866106 13587296 ~ 13590570 (-) True XLOC_006510
TCONS_00012601 other downstream 2970684 12481378 ~ 12485992 (-) False XLOC_006499
TCONS_00012658 other upstream 850143 16307767 ~ 16307883 (-) True XLOC_006537
TCONS_00012667 other upstream 2317033 17774657 ~ 17860347 (-) False XLOC_006543
TCONS_00012681 other upstream 3187266 18644890 ~ 18645005 (-) True XLOC_006551
TCONS_00012682 other upstream 3191868 18649492 ~ 18649682 (-) True XLOC_006552
TCONS_00012685 other upstream 3257686 18715310 ~ 18715426 (-) True XLOC_006554

Expression Profile

//