RNA id: TCONS_00012844


Basic Information

Item Value
RNA id TCONS_00012844
length 518
RNA type mRNA
GC content 0.52
exon number 3
gene id XLOC_006652
representative True

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 27378857 ~ 27621246 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACTGAACTCAGCCATGGGTCCACATCAGACACTCAGCACCAAAGCCAGGAACCTTTCCTCTCCTTCTCTACACTTGTATTACAGCCAGAGCAAGAAGAAACACGCTGGGGTGGATCAGATACTGGGCAAGGGCCAGATTTCAGTGGACAGAAAAGGCAGAGAGAAAATCCTCCCAGAAGGAGAGTCTCTGGAGCATGACATGAGCATGCTTGGCCGCGTCTGTAAAGTAGAGAGACAAGTCCAGTCCATAGAGTCAAAGTTGGACTCATTGCTGGATATATACCGGCAGGTGTTGCAGAAAGGCTCCTCTTCGATGCTCGGGTTGTCTGCTTTGCCACTATTTGAGCTGGATCAGACCTCCGACTACCAAAGTTCCCTCCATAGCAAGGAATCTTCCTCCCAGCTCACCGGTAGTGGAGTGTCTCGTTCCTGCAGCAGTAACCTGCACCGCGGTCTTCATCTTGCTTTGGCCCCTAGTGAACTCAACTTGGGTACCGGTTACCCACATTCAGCCTCCT

Function

GO:

id name namespace
GO:0071805 potassium ion transmembrane transport biological_process
GO:0055085 transmembrane transport biological_process
GO:0006811 ion transport biological_process
GO:0006813 potassium ion transport biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008076 voltage-gated potassium channel complex cellular_component
GO:0005516 calmodulin binding molecular_function
GO:0005216 ion channel activity molecular_function
GO:0005249 voltage-gated potassium channel activity molecular_function
GO:0005251 delayed rectifier potassium channel activity molecular_function
GO:0005267 potassium channel activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-090312-185 Predicted to enable calmodulin binding activity and delayed rectifier potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to act upstream of or within potassium ion transport; regulation of ion transmembrane transport; and transmembrane transport. Predicted to be located in membrane. Predicted to be part of voltage-gated potassium channel complex. Predicted to be integral component of membrane. Is expressed in central nervous system; cerebellum; optic tectum; preoptic area; and telencephalon. Human ortholog(s) of this gene implicated in autosomal dominant mental retardation 46. Orthologous to human KCNQ5 (potassium voltage-gated channel subfamily Q member 5).

Ensembl:

ensembl_id ENSDART00000146230

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00013806 lncRNA downstream 101909 27271338 ~ 27277709 (-) True XLOC_006650
TCONS_00013805 lncRNA downstream 151868 27227361 ~ 27227750 (-) True XLOC_006649
TCONS_00012837 lncRNA downstream 341211 27000394 ~ 27038407 (-) True XLOC_006648
TCONS_00012836 lncRNA downstream 580445 26797396 ~ 26799173 (-) True XLOC_006647
TCONS_00012835 lncRNA downstream 593534 26780568 ~ 26786084 (-) False XLOC_006647
TCONS_00013807 lncRNA upstream 416718 27801415 ~ 27816607 (-) False XLOC_006655
TCONS_00013808 lncRNA upstream 416718 27801415 ~ 27816617 (-) False XLOC_006655
TCONS_00013809 lncRNA upstream 416718 27801415 ~ 27816641 (-) True XLOC_006655
TCONS_00013810 lncRNA upstream 1042780 28427477 ~ 28444818 (-) True XLOC_006663
TCONS_00013811 lncRNA upstream 1113105 28497802 ~ 28513141 (-) False XLOC_006664
TCONS_00012839 mRNA downstream 25585 27332656 ~ 27354033 (-) False XLOC_006651
TCONS_00012840 mRNA downstream 25615 27332666 ~ 27354003 (-) True XLOC_006651
TCONS_00012838 mRNA downstream 341211 27000394 ~ 27038407 (-) False XLOC_006648
TCONS_00012834 mRNA downstream 580374 26780004 ~ 26799244 (-) False XLOC_006647
TCONS_00012825 mRNA downstream 1537544 25824345 ~ 25842074 (-) False XLOC_006642
TCONS_00012845 mRNA upstream 247229 27631926 ~ 27660955 (-) False XLOC_006653
TCONS_00012847 mRNA upstream 247229 27631926 ~ 27767443 (-) False XLOC_006653
TCONS_00012846 mRNA upstream 247229 27631926 ~ 27767443 (-) False XLOC_006653
TCONS_00012848 mRNA upstream 249826 27634523 ~ 27653679 (-) False XLOC_006653
TCONS_00012850 mRNA upstream 273872 27658569 ~ 27660955 (-) False XLOC_006653
TCONS_00012832 other downstream 812434 26567066 ~ 26567184 (-) True XLOC_006646
TCONS_00012810 other downstream 1831004 25545676 ~ 25548614 (-) False XLOC_006634
TCONS_00012805 other downstream 1848970 25530534 ~ 25530648 (-) True XLOC_006633
TCONS_00012791 other downstream 2180393 25058733 ~ 25199225 (-) False XLOC_006628
TCONS_00012849 other upstream 266482 27651179 ~ 27663072 (-) False XLOC_006653
TCONS_00012853 other upstream 305463 27690160 ~ 27690276 (-) True XLOC_006654
TCONS_00012858 other upstream 794737 28179434 ~ 28179550 (-) True XLOC_006658
TCONS_00012861 other upstream 892201 28276898 ~ 28295414 (-) False XLOC_006661
TCONS_00012862 other upstream 901165 28285862 ~ 28417158 (-) True XLOC_006661

Expression Profile

//