RNA id: TCONS_00012927


Basic Information

Item Value
RNA id TCONS_00012927
length 573
RNA type mRNA
GC content 0.39
exon number 5
gene id XLOC_006712
representative False

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 31343326 ~ 31370184 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTCTGATGGACGACTGATCATCAAGGAAGAAGATGACGATGATTATGAAGAGGAAAAAACTAAAGATGCTGAAATGGATGATGTACTTGAAGAGGCAGGAGTCAAAACTAAGAAAAATCCAAAGAGGAAAATTGCAGCTGATCTGGATGATGACATGGATGTTGAGCCTGCACTGAAATATAAAGCTGGTGGCATTGGAATCCACAGGCCACTGGGTGGAAGACCGGAGATCGGGACAGAGTATAAATCTAAGAAAGGAGCGCTTTCTGGATCCCGAATACTGAAGAAGAGGAAAGCCTAAAACTTGTGGGTGTCTAGATATGGAACTTTTTCTAGATTTGCCCTTATTTCTCATGACATGATCAATAAAAAAAGCTAGAGACATCTTGTTTTTTGTCCAAATATTATGTGAGAACTTCCCGTGAAAACTTCTCTTCAAAGAGAGTTTCAAGAAGTCCTTGTCGATGTTTGCTGTGGTGGGATTATAAGAAAATAGCAGTACGACAGTAGCGTTGTAACAAATGTATTTATGTTCTTGCTATATTGGACACCAAATAAAGTGGCCCGAAAATA

Function

GO:

id name namespace
GO:0006364 rRNA processing biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005730 nucleolus cellular_component

KEGG:

id description
ko03009 Ribosome biogenesis

ZFIN:

id description
ZDB-GENE-050706-182 Predicted to be involved in rRNA processing. Predicted to be located in membrane and nucleus. Predicted to be integral component of membrane. Predicted to be active in nucleolus. Is expressed in several structures, including alar plate midbrain region; digestive system; intestinal bulb primordium; musculature system; and nervous system. Orthologous to human RRP12 (ribosomal RNA processing 12 homolog).

Ensembl:

ensembl_id ENSDART00000134343

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00012923 lncRNA downstream 176721 31160187 ~ 31166605 (-) False XLOC_006709
TCONS_00013844 lncRNA downstream 220488 31108526 ~ 31122838 (-) True XLOC_006707
TCONS_00013842 lncRNA downstream 220566 31102907 ~ 31122760 (-) False XLOC_006707
TCONS_00013843 lncRNA downstream 220566 31105176 ~ 31122760 (-) False XLOC_006707
TCONS_00013841 lncRNA downstream 250926 31089586 ~ 31092400 (-) True XLOC_006706
TCONS_00012935 lncRNA upstream 48319 31394711 ~ 31397088 (-) True XLOC_006715
TCONS_00013845 lncRNA upstream 453640 31800032 ~ 31800406 (-) True XLOC_006723
TCONS_00013846 lncRNA upstream 603765 31950157 ~ 31953845 (-) False XLOC_006727
TCONS_00013847 lncRNA upstream 603765 31950157 ~ 31955798 (-) True XLOC_006727
TCONS_00013489 lncRNA upstream 636669 31983061 ~ 31995753 (-) False XLOC_006728
TCONS_00012926 mRNA downstream 46968 31292700 ~ 31296358 (-) True XLOC_006711
TCONS_00012922 mRNA downstream 175865 31148237 ~ 31167461 (-) False XLOC_006709
TCONS_00012921 mRNA downstream 175865 31148237 ~ 31167461 (-) False XLOC_006709
TCONS_00012919 mRNA downstream 176763 31147937 ~ 31166563 (-) False XLOC_006709
TCONS_00012918 mRNA downstream 176767 31147518 ~ 31166559 (-) False XLOC_006709
TCONS_00012931 mRNA upstream 25144 31371536 ~ 31377299 (-) False XLOC_006713
TCONS_00012932 mRNA upstream 26100 31372492 ~ 31378683 (-) True XLOC_006713
TCONS_00012933 mRNA upstream 33392 31379784 ~ 31389661 (-) True XLOC_006714
TCONS_00012934 mRNA upstream 46800 31393192 ~ 31397987 (-) False XLOC_006715
TCONS_00012936 mRNA upstream 78194 31424586 ~ 31435137 (-) False XLOC_006716
TCONS_00012925 other downstream 138133 31193485 ~ 31205193 (-) True XLOC_006710
TCONS_00012917 other downstream 216280 31126449 ~ 31127046 (-) True XLOC_006708
TCONS_00012916 other downstream 267379 31075833 ~ 31075947 (-) True XLOC_006705
TCONS_00012906 other downstream 470887 30855319 ~ 30872439 (-) True XLOC_006699
TCONS_00012900 other downstream 642867 30664819 ~ 30700459 (-) False XLOC_006695
TCONS_00012930 other upstream 203 31346595 ~ 31351772 (-) True XLOC_006712
TCONS_00012938 other upstream 78198 31424590 ~ 31440940 (-) False XLOC_006716
TCONS_00012942 other upstream 233056 31579448 ~ 31579564 (-) True XLOC_006718
TCONS_00012944 other upstream 290340 31636732 ~ 31647006 (-) False XLOC_006720
TCONS_00012947 other upstream 348539 31694931 ~ 31695047 (-) True XLOC_006722

Expression Profile

//