RNA id: TU25397



Basic Information


Item Value
RNA id TU25397
length 291
lncRNA type sense_over
GC content 0.31
exon number 1
gene id CI01000003_00390997_00406970
representative False

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 390622 ~ 408312 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CGTAGCGCCACCTAATGGACCGCGCATTCCGAATTTAAAGGAATAATTTCCATTCATTGTCATTGTATGTAAAACCCTCTCAATGTTCATTTTATTTTATTTTAACAGAAGAAAGAAAGTCGTTTAGAATGACCTGAGAGTGAGTAGATGATGACACTTAATCTTTTTGGGGTAAACTAACCAAAATAAACAATCAAAGAAATAACTAAATAAATGAGCAATAATAGGTAGTAGTAGTGACAATAGACGTACTTATTATAAATAATACGTAGTGTGTATATATACGTAAAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25391 lncRNA upstream 17803 372551 ~ 372819 (+) True G22506
TU25386 lncRNA upstream 33808 356555 ~ 356814 (+) True G22501
TU25281 lncRNA upstream 65100 324681 ~ 325522 (+) True G22419
TU25355 lncRNA upstream 73598 316746 ~ 317024 (+) True G22484
TU25354 lncRNA upstream 74819 315575 ~ 315803 (+) True G22483
TU25370 lncRNA downstream 19651 410563 ~ 411612 (+) False G22488
TU25369 lncRNA downstream 19848 410760 ~ 411612 (+) True G22488
TU25373 lncRNA downstream 59636 450548 ~ 451101 (+) True G22490
TU25409 lncRNA downstream 77761 468673 ~ 468902 (+) True G22524
TU25429 lncRNA downstream 131237 522149 ~ 522653 (+) True G22544
CI01000003_00380494_00385991.mRNA mRNA upstream 4531 380494 ~ 386091 (+) True CI01000003_00380494_00385991
CI01000003_00355244_00360638.mRNA mRNA upstream 29829 355244 ~ 360793 (+) True CI01000003_00355244_00360638
CI01000003_00323130_00336023.mRNA mRNA upstream 54454 322867 ~ 336168 (+) True CI01000003_00323130_00336023
CI01000003_00266342_00275005.mRNA mRNA upstream 115310 266342 ~ 275312 (+) False CI01000003_00266342_00275005
CI01000003_00157111_00159800.mRNA mRNA upstream 230378 156863 ~ 160244 (+) True CI01000003_00157111_00159800
CI01000003_00413809_00414819.mRNA mRNA downstream 21678 412590 ~ 415156 (+) True CI01000003_00413809_00414819
CI01000003_00431473_00447759.mRNA mRNA downstream 40561 431473 ~ 447950 (+) True CI01000003_00431473_00447759
CI01000003_00538178_00547944.mRNA mRNA downstream 147173 538085 ~ 547983 (+) True CI01000003_00538178_00547944
CI01000003_00568546_00573291.mRNA mRNA downstream 177634 568546 ~ 573869 (+) True CI01000003_00568546_00573291
CI01000003_00596144_00607951.mRNA mRNA downstream 205232 596144 ~ 608038 (+) True CI01000003_00596144_00607951
TU25282 other upstream 201183 179531 ~ 189439 (+) True G22420
TU25360 other downstream 101 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25485 other downstream 533891 924803 ~ 925248 (+) True G22578
TU26311 other downstream 1472356 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 1472356 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 1473696 1864608 ~ 1866921 (+) True G23315

Expression Profile


TU25397 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

TU25397 Expression in each Bioproject

Bar chart with 16 bars.
TU25397 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.