RNA id: CI01000003_01258265_01259530.mRNA


Basic Information

Item Value
RNA id CI01000003_01258265_01259530.mRNA
length 378
RNA type mRNA
GC content 0.49
exon number 3
gene id CI01000003_01258265_01259530
representative True

Chromosome Information

Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1258265 ~ 1259551 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence

GCCCAGTCAGAAGGAGCAGTGACCTTCAAAGTCATCCCAGGCACTAAAGAAGAGCTGGAGACCATAGATACCAAGATCTTTGTGAGGGCACTTTTTGACTATGATCCCCAAGCAGATCCCGCTATTCCATGCAAAGATGCCGGGTTGGAATTCCATAGAGGAGATGTGTTACAGATTGTAAGCCTAGAAGATGACACCTGGTGGCAGGCCAGACAGTACGGTAACGCCAACCTCAGGGCTGGGTTGATTCCCTCAAGACAGCTTCAGGAAAGGAGAGTGACTTTACAGAGACCTGAAGTTCTGTTTCACCTGCCCAGAGTGTCGAAGGCATTCGGCGGTAAGCTCAGAACTCCATGACAATTACTAGACAGAGCTGTA

Function

GO: NA

KEGG: NA

JBrowse2

Loading

Neighbor

RNA id RNA type direction distance location representative gene id
TU26018 lncRNA upstream 35603 1176830 ~ 1222662 (+) True G23056
TU25999 lncRNA upstream 187757 1070290 ~ 1070508 (+) True G23039
TU25548 lncRNA upstream 329118 928942 ~ 929147 (+) True G22641
TU25532 lncRNA upstream 344471 913534 ~ 913794 (+) True G22625
TU25522 lncRNA upstream 361936 896121 ~ 896329 (+) True G22615
TU26152 lncRNA downstream 68012 1327563 ~ 1327875 (+) True G23175
TU26204 lncRNA downstream 85722 1345273 ~ 1345574 (+) True G23217
TU26210 lncRNA downstream 118508 1378059 ~ 1378355 (+) True G23223
TU26229 lncRNA downstream 226631 1486182 ~ 1486398 (+) True G23242
TU26231 lncRNA downstream 244998 1504549 ~ 1504981 (+) True G23244
CI01000003_01140472_01168860.mRNA mRNA upstream 89365 1140342 ~ 1168900 (+) True CI01000003_01140472_01168860
CI01000003_01126525_01129929.mRNA mRNA upstream 127940 1126098 ~ 1130325 (+) True CI01000003_01126525_01129929
CI01000003_00981851_01059504.mRNA mRNA upstream 198761 981851 ~ 1059504 (+) True CI01000003_00981851_01059504
CI01000003_00842413_00868623.mRNA mRNA upstream 389602 842413 ~ 868663 (+) True CI01000003_00842413_00868623
CI01000003_00747650_00802075.mRNA mRNA upstream 455584 746547 ~ 802681 (+) True CI01000003_00747650_00802075
CI01000003_01280201_01309764.mRNA mRNA downstream 20216 1279767 ~ 1310125 (+) True CI01000003_01280201_01309764
CI01000003_01329453_01342093.mRNA mRNA downstream 69902 1329453 ~ 1342672 (+) True CI01000003_01329453_01342093
CI01000003_01356590_01360272.mRNA mRNA downstream 96926 1356477 ~ 1360348 (+) True CI01000003_01356590_01360272
CI01000003_01382733_01410162.mRNA mRNA downstream 122897 1382448 ~ 1410190 (+) True CI01000003_01382733_01410162
CI01000003_01430247_01451033.mRNA mRNA downstream 170696 1430247 ~ 1451626 (+) True CI01000003_01430247_01451033
TU25485 other upstream 333017 924803 ~ 925248 (+) True G22578
TU25360 other upstream 863051 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 1068826 179531 ~ 189439 (+) True G22420
TU26311 other downstream 603717 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 603717 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 605057 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1021109 2280660 ~ 2285641 (+) True G23870

Expression Profile

CI01000003_01258265_01259530.mRNA Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

CI01000003_01258265_01259530.mRNA Expression in each Bioproject

Bar chart with 7 bars.
CI01000003_01258265_01259530.mRNA Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
zebrafish (Danio rerio) TCONS_00030457 True 714 mRNA 0.51 7 NC_007113.7 3881000 ~ 3894103 (+)