RNA id: TU25295



Basic Information


Item Value
RNA id TU25295
length 292
lncRNA type inter_gene
GC content 0.28
exon number 1
gene id G22433
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 206981 ~ 207272 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CATCTCTGTTTGAACCCTGAAATTGCTGTCATTTGTGGAATTATCATCTTTACGCGGGTTGTGCATCGGCACGGCTCCCTTAGCGAGGAAGAATCTAATGTTTTGAGGTGTATATGTGGGTTGTCTATCAATGCACCAGTTGTCAACGATGATTGTCATTTTGAACTTGTTGGATTACAAACCAGCATCAAAATGACAAGTTTAATTACATTCCAGCTGCTGTAAGAAGAGGCTACACACAATCTACCGCCTGCTGCATCCACGCACATGCAATATAGCCAATATAACCCGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25294 lncRNA upstream 295 206369 ~ 206686 (+) True G22432
TU25254 lncRNA upstream 46521 137893 ~ 160460 (+) True G22394
TU25256 lncRNA upstream 60276 145858 ~ 146705 (+) True G22396
TU25253 lncRNA upstream 64468 137893 ~ 142513 (+) False G22394
TU25183 lncRNA upstream 170363 33154 ~ 36618 (+) True G22339
TU25296 lncRNA downstream 311 207583 ~ 207922 (+) True G22434
TU25297 lncRNA downstream 4910 212182 ~ 213447 (+) True G22435
TU25298 lncRNA downstream 6997 214269 ~ 214693 (+) True G22436
TU25304 lncRNA downstream 9340 216612 ~ 218340 (+) False G22437
TU25302 lncRNA downstream 9702 216974 ~ 218340 (+) True G22437
CI01000003_00157111_00159800.mRNA mRNA upstream 46737 156863 ~ 160244 (+) True CI01000003_00157111_00159800
CI01000003_00011191_00013812.mRNA mRNA upstream 193083 11191 ~ 13898 (+) False CI01000003_00011191_00013812
CI01000003_00007611_00010967.mRNA mRNA upstream 196014 7611 ~ 10967 (+) True CI01000003_00007611_00010967
CI01000003_00266342_00275005.mRNA mRNA downstream 59070 266342 ~ 275312 (+) False CI01000003_00266342_00275005
CI01000003_00323130_00336023.mRNA mRNA downstream 115595 322867 ~ 336168 (+) True CI01000003_00323130_00336023
CI01000003_00355244_00360638.mRNA mRNA downstream 147972 355244 ~ 360793 (+) True CI01000003_00355244_00360638
CI01000003_00380494_00385991.mRNA mRNA downstream 173222 380494 ~ 386091 (+) True CI01000003_00380494_00385991
CI01000003_00390997_00406970.mRNA mRNA downstream 183625 390897 ~ 408312 (+) False CI01000003_00390997_00406970
TU25282 other upstream 17542 179531 ~ 189439 (+) True G22420
TU25360 other downstream 183741 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25485 other downstream 717531 924803 ~ 925248 (+) True G22578
TU26311 other downstream 1655996 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 1655996 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 1657336 1864608 ~ 1866921 (+) True G23315

Expression Profile


TU25295 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU25295 Expression in each Bioproject

Bar chart with 33 bars.
TU25295 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.