RNA id: TU25355



Basic Information


Item Value
RNA id TU25355
length 279
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G22484
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 316746 ~ 317024 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TAGTTCAGGGCTTTGTGATGGAGGGTCTGTTTATCACTATTTTTTAGGTGGGTATGGAATTTAATGGCCCTTTTTTGAATTGTGATTATAAGTGGGTAAAATCCTAATTCTGCTCTGCAGGCGTTATTTGGGGTTTTGCGCTGTACTCGTAGCAAAACTTTACATAGTTCGGTCTGCAGAGTCTCTATTGGGTGTTTGTCCCATTTAGTGAACTCTTGGTTTGTGAGTGGGCCCCAGACTTCACACCCGTAGAGCGCGATGGGTTCTATTACTGATTTG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25354 lncRNA upstream 943 315575 ~ 315803 (+) True G22483
TU25352 lncRNA upstream 3730 312795 ~ 313016 (+) True G22481
TU25351 lncRNA upstream 4041 312497 ~ 312705 (+) True G22480
TU25346 lncRNA upstream 8899 307630 ~ 307847 (+) True G22475
TU25345 lncRNA upstream 9520 306992 ~ 307226 (+) True G22474
TU25281 lncRNA downstream 7657 324681 ~ 325522 (+) True G22419
TU25386 lncRNA downstream 39531 356555 ~ 356814 (+) True G22501
TU25391 lncRNA downstream 55527 372551 ~ 372819 (+) True G22506
TU25397 lncRNA downstream 73598 390622 ~ 390912 (+) False CI01000003_00390997_00406970
TU25370 lncRNA downstream 93539 410563 ~ 411612 (+) False G22488
CI01000003_00266342_00275005.mRNA mRNA upstream 41434 266342 ~ 275312 (+) False CI01000003_00266342_00275005
CI01000003_00157111_00159800.mRNA mRNA upstream 156502 156863 ~ 160244 (+) True CI01000003_00157111_00159800
CI01000003_00011191_00013812.mRNA mRNA upstream 302848 11191 ~ 13898 (+) False CI01000003_00011191_00013812
CI01000003_00007611_00010967.mRNA mRNA upstream 305779 7611 ~ 10967 (+) True CI01000003_00007611_00010967
CI01000003_00323130_00336023.mRNA mRNA downstream 5843 322867 ~ 336168 (+) True CI01000003_00323130_00336023
CI01000003_00355244_00360638.mRNA mRNA downstream 38220 355244 ~ 360793 (+) True CI01000003_00355244_00360638
CI01000003_00380494_00385991.mRNA mRNA downstream 63470 380494 ~ 386091 (+) True CI01000003_00380494_00385991
CI01000003_00390997_00406970.mRNA mRNA downstream 73873 390897 ~ 408312 (+) False CI01000003_00390997_00406970
CI01000003_00413809_00414819.mRNA mRNA downstream 95566 412590 ~ 415156 (+) True CI01000003_00413809_00414819
TU25282 other upstream 127307 179531 ~ 189439 (+) True G22420
TU25360 other downstream 73989 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25485 other downstream 607779 924803 ~ 925248 (+) True G22578
TU26311 other downstream 1546244 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 1546244 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 1547584 1864608 ~ 1866921 (+) True G23315

Expression Profile


TU25355 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU25355 Expression in each Bioproject

Bar chart with 38 bars.
TU25355 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.