RNA id: TU25391



Basic Information


Item Value
RNA id TU25391
length 269
lncRNA type inter_gene
GC content 0.33
exon number 1
gene id G22506
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 372551 ~ 372819 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GAGATACTTTACCAGTGTGCTGGTTTGATCCATGGCTGGCCTACTGAAACTTTTTATCCAGCAAAGTTATATTTTTAACCATCTTAAAGATCCTGCTGCTTCACTAGCAAGACATTCCATAGGTTTTGCTGGTGAATCATACGGATACTGTATAAAAGCACCTAATCTTTTTTATATAAATAAAGCTCTACATTATTATTAATGAGATTTTACATCAACTCATTAAACTGATTGTTATTTCACAGCAACAGGAAAATTGAACAGTAAAT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25386 lncRNA upstream 15737 356555 ~ 356814 (+) True G22501
TU25281 lncRNA upstream 47029 324681 ~ 325522 (+) True G22419
TU25355 lncRNA upstream 55527 316746 ~ 317024 (+) True G22484
TU25354 lncRNA upstream 56748 315575 ~ 315803 (+) True G22483
TU25352 lncRNA upstream 59535 312795 ~ 313016 (+) True G22481
TU25397 lncRNA downstream 17803 390622 ~ 390912 (+) False CI01000003_00390997_00406970
TU25370 lncRNA downstream 37744 410563 ~ 411612 (+) False G22488
TU25369 lncRNA downstream 37941 410760 ~ 411612 (+) True G22488
TU25373 lncRNA downstream 77729 450548 ~ 451101 (+) True G22490
TU25409 lncRNA downstream 95854 468673 ~ 468902 (+) True G22524
CI01000003_00355244_00360638.mRNA mRNA upstream 11758 355244 ~ 360793 (+) True CI01000003_00355244_00360638
CI01000003_00323130_00336023.mRNA mRNA upstream 36383 322867 ~ 336168 (+) True CI01000003_00323130_00336023
CI01000003_00266342_00275005.mRNA mRNA upstream 97239 266342 ~ 275312 (+) False CI01000003_00266342_00275005
CI01000003_00157111_00159800.mRNA mRNA upstream 212307 156863 ~ 160244 (+) True CI01000003_00157111_00159800
CI01000003_00011191_00013812.mRNA mRNA upstream 358653 11191 ~ 13898 (+) False CI01000003_00011191_00013812
CI01000003_00380494_00385991.mRNA mRNA downstream 7675 380494 ~ 386091 (+) True CI01000003_00380494_00385991
CI01000003_00390997_00406970.mRNA mRNA downstream 18078 390897 ~ 408312 (+) False CI01000003_00390997_00406970
CI01000003_00413809_00414819.mRNA mRNA downstream 39771 412590 ~ 415156 (+) True CI01000003_00413809_00414819
CI01000003_00431473_00447759.mRNA mRNA downstream 58654 431473 ~ 447950 (+) True CI01000003_00431473_00447759
CI01000003_00538178_00547944.mRNA mRNA downstream 165266 538085 ~ 547983 (+) True CI01000003_00538178_00547944
TU25282 other upstream 183112 179531 ~ 189439 (+) True G22420
TU25360 other downstream 18194 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25485 other downstream 551984 924803 ~ 925248 (+) True G22578
TU26311 other downstream 1490449 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 1490449 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 1491789 1864608 ~ 1866921 (+) True G23315

Expression Profile


TU25391 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

TU25391 Expression in each Bioproject

Bar chart with 5 bars.
TU25391 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.