RNA id: TU25429



Basic Information


Item Value
RNA id TU25429
length 429
lncRNA type inter_gene
GC content 0.42
exon number 2
gene id G22544
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 522149 ~ 522653 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TTTATGTTCAGCCGCAATTGTGACCGGTAGAATAATGTGTAACGTTACGTTATACTGAAAATATAGCCTATCAGCCCAGTTATTTAACACATTTTAAACTCTTTCATATCATTTTAGGGTTACTATTAAACATAAATACAACCATCTGTTGTTTTGTTGTGTGGTTAGCACTTTTCATTGCAGGGAACCATTTCAGTTGTCTATCGGGATCCTTAGGAATATGATAAAATGATTTCCCCTTTGCTTTCCCCCGCCTGTTCTAGCATCCTGGCGCACAGCAGCTGTCCACCATGTTGAAATAATAAGGTTTGTAAGGTCTAAACATGTCTGGTTTTAAATTATTGTTCGACCACTATCGATACCAATGCTACAGCCGCTCTAGCACTCTCCTGATGGCCTGCCAAAATGGCGGAGTTTGGATTGCATGAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25409 lncRNA upstream 53247 468673 ~ 468902 (+) True G22524
TU25373 lncRNA upstream 71048 450548 ~ 451101 (+) True G22490
TU25370 lncRNA upstream 110537 410563 ~ 411612 (+) False G22488
TU25369 lncRNA upstream 110537 410760 ~ 411612 (+) True G22488
TU25397 lncRNA upstream 131237 390622 ~ 390912 (+) False CI01000003_00390997_00406970
TU25438 lncRNA downstream 38267 560920 ~ 561612 (+) True G22551
TU25492 lncRNA downstream 59415 582068 ~ 582405 (+) True G22585
TU25490 lncRNA downstream 222028 744681 ~ 744938 (+) True G22583
TU25481 lncRNA downstream 295145 817798 ~ 819540 (+) True G22574
TU25508 lncRNA downstream 356978 879631 ~ 879868 (+) True G22601
CI01000003_00431473_00447759.mRNA mRNA upstream 74199 431473 ~ 447950 (+) True CI01000003_00431473_00447759
CI01000003_00413809_00414819.mRNA mRNA upstream 106993 412590 ~ 415156 (+) True CI01000003_00413809_00414819
CI01000003_00390997_00406970.mRNA mRNA upstream 113837 390897 ~ 408312 (+) False CI01000003_00390997_00406970
CI01000003_00380494_00385991.mRNA mRNA upstream 136058 380494 ~ 386091 (+) True CI01000003_00380494_00385991
CI01000003_00355244_00360638.mRNA mRNA upstream 161356 355244 ~ 360793 (+) True CI01000003_00355244_00360638
CI01000003_00538178_00547944.mRNA mRNA downstream 15432 538085 ~ 547983 (+) True CI01000003_00538178_00547944
CI01000003_00568546_00573291.mRNA mRNA downstream 45893 568546 ~ 573869 (+) True CI01000003_00568546_00573291
CI01000003_00596144_00607951.mRNA mRNA downstream 73491 596144 ~ 608038 (+) True CI01000003_00596144_00607951
CI01000003_00644619_00663181.mRNA mRNA downstream 121002 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00665762_00716862.mRNA mRNA downstream 142308 664961 ~ 717379 (+) True CI01000003_00665762_00716862
TU25360 other upstream 126935 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 332710 179531 ~ 189439 (+) True G22420
TU25485 other downstream 402150 924803 ~ 925248 (+) True G22578
TU26311 other downstream 1340615 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 1340615 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 1341955 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1758007 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25429 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU25429 Expression in each Bioproject

Bar chart with 34 bars.
TU25429 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.