RNA id: TU25438



Basic Information


Item Value
RNA id TU25438
length 693
lncRNA type inter_gene
GC content 0.38
exon number 1
gene id G22551
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 560920 ~ 561612 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TCGCGTTGTTCCGCAGGGCTCCTCGCAAGTCGCGTCATGGAAGAACAATAAAGCGTCTTTGTTTCACTGCAGCTGACGAGTGGAAACGCTGAAGAGGCAGTGCACGATATAATGAACACAAAGAAAACACATGCCCGTTACACGCCGCATGTCGATAAAAAATAAGAATGATAACAGTGGTTTCTCATTTTATTCTGTTTCATTTGATTCTGCATATTCCCCATTTGAGATTGTAGCAAGTACCGGAAATGGACAGAGCAAGCCATTTTTGTCGTTTTTGATTTACATATTCTTTTGGATGCTTAAAAAAACAGTGTATTGTACAAGATACAATCAAATGAGCAGTAGCCTACCGTAATACCGTATTTGATCTGCGTTTTTGAAAAGTTTGTAAGCTTATGAGCTTTATTGTTAAACGTTGCTGAACAATGTTGAGCTGTTTGAATAAACACAAGGGTCTTCTTGTGATATCTGGCATTTAGTCTATAAGGTCATTCCAATTTGTAAAGAAATGTGAAAATCTTACTTTGTCCATAGGCCTACGTTTGGATGCTACACTGTTATCAGGTGGCCTATGACTCACATTTCCAGTGTACCATTATGTAAATAAACACTTTTATTGATTGATTTTTGCTAGTTATTAAGCTCTGTGCATTTGCAGTATCTTGAAGCACTTGAGAATGACATTTGGGT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25429 lncRNA upstream 38267 522149 ~ 522653 (+) True G22544
TU25409 lncRNA upstream 92018 468673 ~ 468902 (+) True G22524
TU25373 lncRNA upstream 109819 450548 ~ 451101 (+) True G22490
TU25370 lncRNA upstream 149308 410563 ~ 411612 (+) False G22488
TU25369 lncRNA upstream 149308 410760 ~ 411612 (+) True G22488
TU25492 lncRNA downstream 20456 582068 ~ 582405 (+) True G22585
TU25490 lncRNA downstream 183069 744681 ~ 744938 (+) True G22583
TU25481 lncRNA downstream 256186 817798 ~ 819540 (+) True G22574
TU25508 lncRNA downstream 318019 879631 ~ 879868 (+) True G22601
TU25509 lncRNA downstream 318341 879953 ~ 880262 (+) True G22602
CI01000003_00538178_00547944.mRNA mRNA upstream 12937 538085 ~ 547983 (+) True CI01000003_00538178_00547944
CI01000003_00431473_00447759.mRNA mRNA upstream 112970 431473 ~ 447950 (+) True CI01000003_00431473_00447759
CI01000003_00413809_00414819.mRNA mRNA upstream 145764 412590 ~ 415156 (+) True CI01000003_00413809_00414819
CI01000003_00390997_00406970.mRNA mRNA upstream 152608 390897 ~ 408312 (+) False CI01000003_00390997_00406970
CI01000003_00380494_00385991.mRNA mRNA upstream 174829 380494 ~ 386091 (+) True CI01000003_00380494_00385991
CI01000003_00568546_00573291.mRNA mRNA downstream 6934 568546 ~ 573869 (+) True CI01000003_00568546_00573291
CI01000003_00596144_00607951.mRNA mRNA downstream 34532 596144 ~ 608038 (+) True CI01000003_00596144_00607951
CI01000003_00644619_00663181.mRNA mRNA downstream 82043 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00665762_00716862.mRNA mRNA downstream 103349 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_00731635_00742538.mRNA mRNA downstream 169588 731200 ~ 742609 (+) True CI01000003_00731635_00742538
TU25360 other upstream 165706 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 371481 179531 ~ 189439 (+) True G22420
TU25485 other downstream 363191 924803 ~ 925248 (+) True G22578
TU26311 other downstream 1301656 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 1301656 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 1302996 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1719048 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25438 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU25438 Expression in each Bioproject

Bar chart with 41 bars.
TU25438 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.