RNA id: TU25492



Basic Information


Item Value
RNA id TU25492
length 338
lncRNA type inter_gene
GC content 0.38
exon number 1
gene id G22585
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 582068 ~ 582405 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GATTCTTTTCGGCATTGATAATGCTGACACAGCATAAATCCTAGGGCATTTTCACACCTATGGATCATTTGTTTTGTTCCGAAACAGGGATTAAATTTGTTACAATGTTGCATTTTCTTCTTGGTTTGGTTTGCTTTCAACAAGGCAACATTTCAAAGCGTACCAAAATGTGTTTATGCAAGTCACATGTGAGTACAACTGTCCTCTTATTGGTCAGAGTTTTTTCAGCGTCATCCATCGAAATTATTGAACAAGTTCGCTTCATGAGCTCATTGCAGATTTATTTGTAACTGTCGAGACACACACAAACACTATACGAGTGTAGCCGTCATTCCCAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25438 lncRNA upstream 20456 560920 ~ 561612 (+) True G22551
TU25429 lncRNA upstream 59415 522149 ~ 522653 (+) True G22544
TU25409 lncRNA upstream 113166 468673 ~ 468902 (+) True G22524
TU25373 lncRNA upstream 130967 450548 ~ 451101 (+) True G22490
TU25370 lncRNA upstream 170456 410563 ~ 411612 (+) False G22488
TU25490 lncRNA downstream 162276 744681 ~ 744938 (+) True G22583
TU25481 lncRNA downstream 235393 817798 ~ 819540 (+) True G22574
TU25508 lncRNA downstream 297226 879631 ~ 879868 (+) True G22601
TU25509 lncRNA downstream 297548 879953 ~ 880262 (+) True G22602
TU25510 lncRNA downstream 298216 880621 ~ 880871 (+) True G22603
CI01000003_00568546_00573291.mRNA mRNA upstream 8199 568546 ~ 573869 (+) True CI01000003_00568546_00573291
CI01000003_00538178_00547944.mRNA mRNA upstream 34085 538085 ~ 547983 (+) True CI01000003_00538178_00547944
CI01000003_00431473_00447759.mRNA mRNA upstream 134118 431473 ~ 447950 (+) True CI01000003_00431473_00447759
CI01000003_00413809_00414819.mRNA mRNA upstream 166912 412590 ~ 415156 (+) True CI01000003_00413809_00414819
CI01000003_00390997_00406970.mRNA mRNA upstream 173756 390897 ~ 408312 (+) False CI01000003_00390997_00406970
CI01000003_00596144_00607951.mRNA mRNA downstream 13739 596144 ~ 608038 (+) True CI01000003_00596144_00607951
CI01000003_00644619_00663181.mRNA mRNA downstream 61250 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00665762_00716862.mRNA mRNA downstream 82556 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_00731635_00742538.mRNA mRNA downstream 148795 731200 ~ 742609 (+) True CI01000003_00731635_00742538
CI01000003_00747650_00802075.mRNA mRNA downstream 164142 746547 ~ 802681 (+) True CI01000003_00747650_00802075
TU25360 other upstream 186854 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 392629 179531 ~ 189439 (+) True G22420
TU25485 other downstream 342398 924803 ~ 925248 (+) True G22578
TU26311 other downstream 1280863 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 1280863 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 1282203 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1698255 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25492 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU25492 Expression in each Bioproject

Bar chart with 41 bars.
TU25492 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2500.
End of interactive chart.