RNA id: TU25490



Basic Information


Item Value
RNA id TU25490
length 258
lncRNA type inter_gene
GC content 0.28
exon number 1
gene id G22583
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 744681 ~ 744938 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


ACTAAAATTAAGTTCTTTCATCACTTGTTTAACTTTACATTTTAACCAAGATGTCTATGGCTCAATTAGTCATTTTATAAAAGAAATATTATATAAATGTTATACAATAATAAAAGTAATCTGATAATGCAATTTCCATTAGAGAAATTGGCTACATTTTAACCAAATTTACAAATAGTAGGCAGTGAAACCAGTAAAAGACGTAGGGGTAACTCTTTAGAATAATGGTCTGTCATTAAGCTAACTATGCAGGGAGTA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25492 lncRNA upstream 162276 582068 ~ 582405 (+) True G22585
TU25438 lncRNA upstream 183069 560920 ~ 561612 (+) True G22551
TU25429 lncRNA upstream 222028 522149 ~ 522653 (+) True G22544
TU25409 lncRNA upstream 275779 468673 ~ 468902 (+) True G22524
TU25373 lncRNA upstream 293580 450548 ~ 451101 (+) True G22490
TU25481 lncRNA downstream 72860 817798 ~ 819540 (+) True G22574
TU25508 lncRNA downstream 134693 879631 ~ 879868 (+) True G22601
TU25509 lncRNA downstream 135015 879953 ~ 880262 (+) True G22602
TU25510 lncRNA downstream 135683 880621 ~ 880871 (+) True G22603
TU25512 lncRNA downstream 137667 882605 ~ 882932 (+) True G22605
CI01000003_00731635_00742538.mRNA mRNA upstream 2072 731200 ~ 742609 (+) True CI01000003_00731635_00742538
CI01000003_00665762_00716862.mRNA mRNA upstream 27302 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_00644619_00663181.mRNA mRNA upstream 81401 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00596144_00607951.mRNA mRNA upstream 136643 596144 ~ 608038 (+) True CI01000003_00596144_00607951
CI01000003_00568546_00573291.mRNA mRNA upstream 170812 568546 ~ 573869 (+) True CI01000003_00568546_00573291
CI01000003_00747650_00802075.mRNA mRNA downstream 1609 746547 ~ 802681 (+) True CI01000003_00747650_00802075
CI01000003_00842413_00868623.mRNA mRNA downstream 97475 842413 ~ 868663 (+) True CI01000003_00842413_00868623
CI01000003_00981851_01059504.mRNA mRNA downstream 236913 981851 ~ 1059504 (+) True CI01000003_00981851_01059504
CI01000003_01126525_01129929.mRNA mRNA downstream 381160 1126098 ~ 1130325 (+) True CI01000003_01126525_01129929
CI01000003_01140472_01168860.mRNA mRNA downstream 395404 1140342 ~ 1168900 (+) True CI01000003_01140472_01168860
TU25360 other upstream 349467 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 555242 179531 ~ 189439 (+) True G22420
TU25485 other downstream 179865 924803 ~ 925248 (+) True G22578
TU26311 other downstream 1118330 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 1118330 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 1119670 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1535722 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25490 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

TU25490 Expression in each Bioproject

Bar chart with 4 bars.
TU25490 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.