RNA id: TU25508



Basic Information


Item Value
RNA id TU25508
length 238
lncRNA type inter_gene
GC content 0.56
exon number 1
gene id G22601
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 879631 ~ 879868 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GGAGAGAGTTTATATACAAAGTGCTGATGAGGGAGTGCAGGTGTCGGGAATCCATGATGATGAGCTGACTGGTGCAGGTGTGGGTCAGATGGAATTATGGGAAATGGAGTTCGGGGACGGTGAGACAGATGGTGACAGTGACATTACTCCCCCCTCCCGGTAGGCGCGACCTCGCGTCGTAGATAGATAACCGGGAGAGAGGGTGGGCGTCCTGGAGACGTGATGGGTGCTGCAGGGT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25481 lncRNA upstream 60091 817798 ~ 819540 (+) True G22574
TU25490 lncRNA upstream 134693 744681 ~ 744938 (+) True G22583
TU25492 lncRNA upstream 297226 582068 ~ 582405 (+) True G22585
TU25438 lncRNA upstream 318019 560920 ~ 561612 (+) True G22551
TU25429 lncRNA upstream 356978 522149 ~ 522653 (+) True G22544
TU25509 lncRNA downstream 85 879953 ~ 880262 (+) True G22602
TU25510 lncRNA downstream 753 880621 ~ 880871 (+) True G22603
TU25512 lncRNA downstream 2737 882605 ~ 882932 (+) True G22605
TU25522 lncRNA downstream 16253 896121 ~ 896329 (+) True G22615
TU25532 lncRNA downstream 33666 913534 ~ 913794 (+) True G22625
CI01000003_00842413_00868623.mRNA mRNA upstream 10968 842413 ~ 868663 (+) True CI01000003_00842413_00868623
CI01000003_00747650_00802075.mRNA mRNA upstream 76950 746547 ~ 802681 (+) True CI01000003_00747650_00802075
CI01000003_00731635_00742538.mRNA mRNA upstream 137022 731200 ~ 742609 (+) True CI01000003_00731635_00742538
CI01000003_00665762_00716862.mRNA mRNA upstream 162252 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_00644619_00663181.mRNA mRNA upstream 216351 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00981851_01059504.mRNA mRNA downstream 101983 981851 ~ 1059504 (+) True CI01000003_00981851_01059504
CI01000003_01126525_01129929.mRNA mRNA downstream 246230 1126098 ~ 1130325 (+) True CI01000003_01126525_01129929
CI01000003_01140472_01168860.mRNA mRNA downstream 260474 1140342 ~ 1168900 (+) True CI01000003_01140472_01168860
CI01000003_01258265_01259530.mRNA mRNA downstream 378397 1258265 ~ 1259551 (+) True CI01000003_01258265_01259530
CI01000003_01280201_01309764.mRNA mRNA downstream 399899 1279767 ~ 1310125 (+) True CI01000003_01280201_01309764
TU25360 other upstream 484417 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 690192 179531 ~ 189439 (+) True G22420
TU25485 other downstream 44935 924803 ~ 925248 (+) True G22578
TU26311 other downstream 983400 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 983400 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 984740 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1400792 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25508 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU25508 Expression in each Bioproject

Bar chart with 8 bars.
TU25508 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.