RNA id: TU25510



Basic Information


Item Value
RNA id TU25510
length 251
lncRNA type inter_gene
GC content 0.46
exon number 1
gene id G22603
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 880621 ~ 880871 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GTTGCAATCAAGGTGCGGATGCAGGATCAAGATAAGCAGCAAAGGTTTTATTAACAATACTTTAAACACTGGAACAGGAACAGGAGCAGAACAACTAACCATACAAAGATGAGAACAGACAAAGGAGTGCAGGAGGAGAGAGTCTATAAACGAAGTGCTGATGAGGGAGTGCAGGTGTCGGGAATCCATGAAGATGATCTGACTGGGTGCAGGTGTGGGTCAGAGAGGATTATGGGAAATGGAGTCCAGGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25509 lncRNA upstream 359 879953 ~ 880262 (+) True G22602
TU25508 lncRNA upstream 753 879631 ~ 879868 (+) True G22601
TU25481 lncRNA upstream 61081 817798 ~ 819540 (+) True G22574
TU25490 lncRNA upstream 135683 744681 ~ 744938 (+) True G22583
TU25492 lncRNA upstream 298216 582068 ~ 582405 (+) True G22585
TU25512 lncRNA downstream 1734 882605 ~ 882932 (+) True G22605
TU25522 lncRNA downstream 15250 896121 ~ 896329 (+) True G22615
TU25532 lncRNA downstream 32663 913534 ~ 913794 (+) True G22625
TU25548 lncRNA downstream 48071 928942 ~ 929147 (+) True G22641
TU25999 lncRNA downstream 189419 1070290 ~ 1070508 (+) True G23039
CI01000003_00842413_00868623.mRNA mRNA upstream 11958 842413 ~ 868663 (+) True CI01000003_00842413_00868623
CI01000003_00747650_00802075.mRNA mRNA upstream 77940 746547 ~ 802681 (+) True CI01000003_00747650_00802075
CI01000003_00731635_00742538.mRNA mRNA upstream 138012 731200 ~ 742609 (+) True CI01000003_00731635_00742538
CI01000003_00665762_00716862.mRNA mRNA upstream 163242 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_00644619_00663181.mRNA mRNA upstream 217341 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00981851_01059504.mRNA mRNA downstream 100980 981851 ~ 1059504 (+) True CI01000003_00981851_01059504
CI01000003_01126525_01129929.mRNA mRNA downstream 245227 1126098 ~ 1130325 (+) True CI01000003_01126525_01129929
CI01000003_01140472_01168860.mRNA mRNA downstream 259471 1140342 ~ 1168900 (+) True CI01000003_01140472_01168860
CI01000003_01258265_01259530.mRNA mRNA downstream 377394 1258265 ~ 1259551 (+) True CI01000003_01258265_01259530
CI01000003_01280201_01309764.mRNA mRNA downstream 398896 1279767 ~ 1310125 (+) True CI01000003_01280201_01309764
TU25360 other upstream 485407 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 691182 179531 ~ 189439 (+) True G22420
TU25485 other downstream 43932 924803 ~ 925248 (+) True G22578
TU26311 other downstream 982397 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 982397 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 983737 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1399789 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25510 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.4.
End of interactive chart.

TU25510 Expression in each Bioproject

Bar chart with 10 bars.
TU25510 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.