RNA id: TU25512



Basic Information


Item Value
RNA id TU25512
length 328
lncRNA type inter_gene
GC content 0.50
exon number 1
gene id G22605
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 882605 ~ 882932 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TTTTTTACCAACTTATTAACTCTATACATACAGTTGAGCTCAAAAGTTTACATACCCCTTGCAGAATCTGCAAAAATGTTAATCATTTTAACAAAATAAGAAGGATCATGAAAATTGCATGTTATTTTTTATTTAGTACTGTCCTTAATAAACTATTTCACATAACAGTTGTTTACATAAAGTCCACAAGACAAAAAAATAGCAGAATTTATAAAAATGACCCCATTCAAAAGTTTACATACCCTTGATTCTTAATACTGTGTGTCGTTTCCTGGATGATCCATGACTATTTTTTTGTTTTGTGATGGTTGTCCCTTGTTTGTTCTGA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25510 lncRNA upstream 1734 880621 ~ 880871 (+) True G22603
TU25509 lncRNA upstream 2343 879953 ~ 880262 (+) True G22602
TU25508 lncRNA upstream 2737 879631 ~ 879868 (+) True G22601
TU25481 lncRNA upstream 63065 817798 ~ 819540 (+) True G22574
TU25490 lncRNA upstream 137667 744681 ~ 744938 (+) True G22583
TU25522 lncRNA downstream 13189 896121 ~ 896329 (+) True G22615
TU25532 lncRNA downstream 30602 913534 ~ 913794 (+) True G22625
TU25548 lncRNA downstream 46010 928942 ~ 929147 (+) True G22641
TU25999 lncRNA downstream 187358 1070290 ~ 1070508 (+) True G23039
TU26018 lncRNA downstream 293898 1176830 ~ 1222662 (+) True G23056
CI01000003_00842413_00868623.mRNA mRNA upstream 13942 842413 ~ 868663 (+) True CI01000003_00842413_00868623
CI01000003_00747650_00802075.mRNA mRNA upstream 79924 746547 ~ 802681 (+) True CI01000003_00747650_00802075
CI01000003_00731635_00742538.mRNA mRNA upstream 139996 731200 ~ 742609 (+) True CI01000003_00731635_00742538
CI01000003_00665762_00716862.mRNA mRNA upstream 165226 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_00644619_00663181.mRNA mRNA upstream 219325 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00981851_01059504.mRNA mRNA downstream 98919 981851 ~ 1059504 (+) True CI01000003_00981851_01059504
CI01000003_01126525_01129929.mRNA mRNA downstream 243166 1126098 ~ 1130325 (+) True CI01000003_01126525_01129929
CI01000003_01140472_01168860.mRNA mRNA downstream 257410 1140342 ~ 1168900 (+) True CI01000003_01140472_01168860
CI01000003_01258265_01259530.mRNA mRNA downstream 375333 1258265 ~ 1259551 (+) True CI01000003_01258265_01259530
CI01000003_01280201_01309764.mRNA mRNA downstream 396835 1279767 ~ 1310125 (+) True CI01000003_01280201_01309764
TU25360 other upstream 487391 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 693166 179531 ~ 189439 (+) True G22420
TU25485 other downstream 41871 924803 ~ 925248 (+) True G22578
TU26311 other downstream 980336 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 980336 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 981676 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1397728 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25512 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU25512 Expression in each Bioproject

Bar chart with 42 bars.
TU25512 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.