RNA id: TU25522



Basic Information


Item Value
RNA id TU25522
length 209
lncRNA type inter_gene
GC content 0.48
exon number 1
gene id G22615
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 896121 ~ 896329 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TTGACCTTGGACTGTTACTCATTTCTGATTCTCTGCTGCCTGCCTTGACCCTTGCCTGTTCCCGGATTGTGTTTGCTGCCTGCCTTGGGACTTTGATTGTTTGCTGCCTACCCTGATCACTGTCTGTCACTGTTTCTGCCACTGGCTCATCCTTGCTATTGTTGTGTCTGTGAACTACACTTCAGTAAAAGCTGCAGATGGATCCTCAT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25512 lncRNA upstream 13189 882605 ~ 882932 (+) True G22605
TU25510 lncRNA upstream 15250 880621 ~ 880871 (+) True G22603
TU25509 lncRNA upstream 15859 879953 ~ 880262 (+) True G22602
TU25508 lncRNA upstream 16253 879631 ~ 879868 (+) True G22601
TU25481 lncRNA upstream 76581 817798 ~ 819540 (+) True G22574
TU25532 lncRNA downstream 17205 913534 ~ 913794 (+) True G22625
TU25548 lncRNA downstream 32613 928942 ~ 929147 (+) True G22641
TU25999 lncRNA downstream 173961 1070290 ~ 1070508 (+) True G23039
TU26018 lncRNA downstream 280501 1176830 ~ 1222662 (+) True G23056
TU26152 lncRNA downstream 431234 1327563 ~ 1327875 (+) True G23175
CI01000003_00842413_00868623.mRNA mRNA upstream 27458 842413 ~ 868663 (+) True CI01000003_00842413_00868623
CI01000003_00747650_00802075.mRNA mRNA upstream 93440 746547 ~ 802681 (+) True CI01000003_00747650_00802075
CI01000003_00731635_00742538.mRNA mRNA upstream 153512 731200 ~ 742609 (+) True CI01000003_00731635_00742538
CI01000003_00665762_00716862.mRNA mRNA upstream 178742 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_00644619_00663181.mRNA mRNA upstream 232841 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00981851_01059504.mRNA mRNA downstream 85522 981851 ~ 1059504 (+) True CI01000003_00981851_01059504
CI01000003_01126525_01129929.mRNA mRNA downstream 229769 1126098 ~ 1130325 (+) True CI01000003_01126525_01129929
CI01000003_01140472_01168860.mRNA mRNA downstream 244013 1140342 ~ 1168900 (+) True CI01000003_01140472_01168860
CI01000003_01258265_01259530.mRNA mRNA downstream 361936 1258265 ~ 1259551 (+) True CI01000003_01258265_01259530
CI01000003_01280201_01309764.mRNA mRNA downstream 383438 1279767 ~ 1310125 (+) True CI01000003_01280201_01309764
TU25360 other upstream 500907 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 706682 179531 ~ 189439 (+) True G22420
TU25485 other downstream 28474 924803 ~ 925248 (+) True G22578
TU26311 other downstream 966939 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 966939 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 968279 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1384331 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25522 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

TU25522 Expression in each Bioproject

Bar chart with 12 bars.
TU25522 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.