RNA id: TU25485



Basic Information


Item Value
RNA id TU25485
length 446
RNA type TUCP
GC content 0.56
exon number 1
gene id G22578
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 924803 ~ 925248 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CATCATTCAAGCATACCAAGCTGACCTGCTGAAGGACTTGGGCGATAGTGAGGAAGTGGGGGCTGATTTCATCCATGAGTTGCGTCAGTCAGCAGATTTAGCGCTCCGTGCCACCAAGGAGACGGCCAAGTCAATCGGCCGCTCTATGGCAGCCCTGGTGGCCACGGAGCGCCACCTCTGGCTAAATCTGTCTGACATTAAAGATCGTGACAAGACGTATCTCTTGGATGCCCCACTGAATCCGTCTGGCCTCTTTGGTGACGCTATCACATCTGTCACCAAGAGGTTTCAGGAGGCGAGGAAGCAGGCTGCTGCTATGCAGCAGTTTCTTCCTCGTCGTGCCCAAGTCCCTTCGGCTGCTGGGCGGGAACAGCCGAAGCCGAGTACGAGCTCCTCGCATCAGCACAGACAACAGCAGAAGCAGAGCGTTGCTACCTGCACTCCCT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25532 lncRNA upstream 11009 913534 ~ 913794 (+) True G22625
TU25522 lncRNA upstream 28474 896121 ~ 896329 (+) True G22615
TU25512 lncRNA upstream 41871 882605 ~ 882932 (+) True G22605
TU25510 lncRNA upstream 43932 880621 ~ 880871 (+) True G22603
TU25509 lncRNA upstream 44541 879953 ~ 880262 (+) True G22602
TU25548 lncRNA downstream 3694 928942 ~ 929147 (+) True G22641
TU25999 lncRNA downstream 145042 1070290 ~ 1070508 (+) True G23039
TU26018 lncRNA downstream 251582 1176830 ~ 1222662 (+) True G23056
TU26152 lncRNA downstream 402315 1327563 ~ 1327875 (+) True G23175
TU26204 lncRNA downstream 420025 1345273 ~ 1345574 (+) True G23217
CI01000003_00842413_00868623.mRNA mRNA upstream 56140 842413 ~ 868663 (+) True CI01000003_00842413_00868623
CI01000003_00747650_00802075.mRNA mRNA upstream 122122 746547 ~ 802681 (+) True CI01000003_00747650_00802075
CI01000003_00731635_00742538.mRNA mRNA upstream 182194 731200 ~ 742609 (+) True CI01000003_00731635_00742538
CI01000003_00665762_00716862.mRNA mRNA upstream 207424 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_00644619_00663181.mRNA mRNA upstream 261523 643655 ~ 663280 (+) True CI01000003_00644619_00663181
CI01000003_00981851_01059504.mRNA mRNA downstream 56603 981851 ~ 1059504 (+) True CI01000003_00981851_01059504
CI01000003_01126525_01129929.mRNA mRNA downstream 200850 1126098 ~ 1130325 (+) True CI01000003_01126525_01129929
CI01000003_01140472_01168860.mRNA mRNA downstream 215094 1140342 ~ 1168900 (+) True CI01000003_01140472_01168860
CI01000003_01258265_01259530.mRNA mRNA downstream 333017 1258265 ~ 1259551 (+) True CI01000003_01258265_01259530
CI01000003_01280201_01309764.mRNA mRNA downstream 354519 1279767 ~ 1310125 (+) True CI01000003_01280201_01309764
TU25360 other upstream 529589 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 735364 179531 ~ 189439 (+) True G22420
TU26311 other downstream 938020 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 938020 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 939360 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1355412 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25485 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU25485 Expression in each Bioproject

Bar chart with 36 bars.
TU25485 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.