RNA id: TU25999



Basic Information


Item Value
RNA id TU25999
length 219
lncRNA type inter_gene
GC content 0.55
exon number 1
gene id G23039
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1070290 ~ 1070508 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


ACACGAACTAGTGGTGAGGAAAGCAGACTGCGGGGTTGGCTCACGTCAGCAGCATCTGGGTCCAAAGTTGCTCTGACACACCAAACCGATGCTCGACACCCGACGGCCAAGTAGCACGTCCGTTCTGCGCCAGCGTAAGAAGAAATTCCTTTCCGTACCAGCAGGTGGCAGTAGCTGAAGAGCCAATCAGAATGATCAGATGGCCTGACTGACGAGCTC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU25548 lncRNA upstream 141143 928942 ~ 929147 (+) True G22641
TU25532 lncRNA upstream 156496 913534 ~ 913794 (+) True G22625
TU25522 lncRNA upstream 173961 896121 ~ 896329 (+) True G22615
TU25512 lncRNA upstream 187358 882605 ~ 882932 (+) True G22605
TU25510 lncRNA upstream 189419 880621 ~ 880871 (+) True G22603
TU26018 lncRNA downstream 106322 1176830 ~ 1222662 (+) True G23056
TU26152 lncRNA downstream 257055 1327563 ~ 1327875 (+) True G23175
TU26204 lncRNA downstream 274765 1345273 ~ 1345574 (+) True G23217
TU26210 lncRNA downstream 307551 1378059 ~ 1378355 (+) True G23223
TU26229 lncRNA downstream 415674 1486182 ~ 1486398 (+) True G23242
CI01000003_00981851_01059504.mRNA mRNA upstream 10786 981851 ~ 1059504 (+) True CI01000003_00981851_01059504
CI01000003_00842413_00868623.mRNA mRNA upstream 201627 842413 ~ 868663 (+) True CI01000003_00842413_00868623
CI01000003_00747650_00802075.mRNA mRNA upstream 267609 746547 ~ 802681 (+) True CI01000003_00747650_00802075
CI01000003_00731635_00742538.mRNA mRNA upstream 327681 731200 ~ 742609 (+) True CI01000003_00731635_00742538
CI01000003_00665762_00716862.mRNA mRNA upstream 352911 664961 ~ 717379 (+) True CI01000003_00665762_00716862
CI01000003_01126525_01129929.mRNA mRNA downstream 55590 1126098 ~ 1130325 (+) True CI01000003_01126525_01129929
CI01000003_01140472_01168860.mRNA mRNA downstream 69834 1140342 ~ 1168900 (+) True CI01000003_01140472_01168860
CI01000003_01258265_01259530.mRNA mRNA downstream 187757 1258265 ~ 1259551 (+) True CI01000003_01258265_01259530
CI01000003_01280201_01309764.mRNA mRNA downstream 209259 1279767 ~ 1310125 (+) True CI01000003_01280201_01309764
CI01000003_01329453_01342093.mRNA mRNA downstream 258945 1329453 ~ 1342672 (+) True CI01000003_01329453_01342093
TU25485 other upstream 145042 924803 ~ 925248 (+) True G22578
TU25360 other upstream 675076 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 880851 179531 ~ 189439 (+) True G22420
TU26311 other downstream 792760 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 792760 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 794100 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 1210152 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU25999 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU25999 Expression in each Bioproject

Bar chart with 23 bars.
TU25999 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.