RNA id: TU26182



Basic Information


Item Value
RNA id TU26182
length 361
lncRNA type read_through
GC content 0.36
exon number 3
gene id G23195
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1614613 ~ 1684836 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


AAGTATTCAGACCCCCTTAAATTTTTCACTCTTTGTTATAACGTTTACCATCCAACCTGACAGAACTGGAGAGGATCTGCAAGGAGGAATGGCAGAGGATCCCCAAATCCAGGTGTGAAAAACTTGTTGCATCTTTCCCAAAAAGACTTATGGCTGTATTAGATCAAAAGGGTGCTTCTACTAAATACTGAGCAAAGGGTCTGAATACTTAGGACCATGTGATATTTCAGTTTTTCTTTTTTAATAAATCTGCAAAAATGTCAACAATTCTGTGTTTTTCTGTCAATATGGGGTGCTGTGTGTACATTAATGAGGAAAAAAAATGAACTTAAATGATTTTAGCAAATGGCTGCAATATAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU26158 lncRNA upstream 13431 1544521 ~ 1601182 (+) True G23180
TU26247 lncRNA upstream 61650 1552468 ~ 1552963 (+) True G23256
TU26240 lncRNA upstream 72177 1542129 ~ 1542436 (+) True G23251
TU26234 lncRNA upstream 106143 1508250 ~ 1508470 (+) True G23246
TU26231 lncRNA upstream 109632 1504549 ~ 1504981 (+) True G23244
TU26286 lncRNA downstream 35864 1720700 ~ 1720940 (+) True G23295
TU26298 lncRNA downstream 43144 1727980 ~ 1728184 (+) True G23304
TU26295 lncRNA downstream 105534 1790370 ~ 1790726 (+) True G23301
TU26292 lncRNA downstream 118728 1803564 ~ 1803914 (+) False CI01000003_01797491_01803265
TU26289 lncRNA downstream 119284 1806353 ~ 1807430 (+) True G23297
CI01000003_01561017_01590804.mRNA mRNA upstream 23690 1560913 ~ 1590923 (+) True CI01000003_01561017_01590804
CI01000003_01489211_01493471.mRNA mRNA upstream 120588 1487837 ~ 1494025 (+) True CI01000003_01489211_01493471
CI01000003_01430247_01451033.mRNA mRNA upstream 162987 1430247 ~ 1451626 (+) True CI01000003_01430247_01451033
CI01000003_01382733_01410162.mRNA mRNA upstream 204423 1382448 ~ 1410190 (+) True CI01000003_01382733_01410162
CI01000003_01356590_01360272.mRNA mRNA upstream 254265 1356477 ~ 1360348 (+) True CI01000003_01356590_01360272
CI01000003_01728663_01761628.mRNA mRNA downstream 43616 1728452 ~ 1762479 (+) True CI01000003_01728663_01761628
CI01000003_01797491_01803265.mRNA mRNA downstream 111785 1796621 ~ 1804384 (+) False CI01000003_01797491_01803265
CI01000003_01863421_01867859.mRNA mRNA downstream 178018 1862854 ~ 1867928 (+) False CI01000003_01863421_01867859
CI01000003_01889537_01891879.mRNA mRNA downstream 204662 1889498 ~ 1892071 (+) True CI01000003_01889537_01891879
CI01000003_01893593_01901539.mRNA mRNA downstream 208757 1893593 ~ 1901769 (+) True CI01000003_01893593_01901539
TU25485 other upstream 689365 924803 ~ 925248 (+) True G22578
TU25360 other upstream 1219399 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU25282 other upstream 1425174 179531 ~ 189439 (+) True G22420
TU26311 other downstream 178432 1863892 ~ 1866921 (+) False G23315
TU26312 other downstream 178432 1864690 ~ 1866921 (+) True G23315
TU26310 other downstream 179772 1864608 ~ 1866921 (+) True G23315
TU26952 other downstream 595824 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU26182 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU26182 Expression in each Bioproject

Bar chart with 36 bars.
TU26182 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.