RNA id: TU26864



Basic Information


Item Value
RNA id TU26864
length 253
lncRNA type inter_gene
GC content 0.34
exon number 2
gene id G23789
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 2207105 ~ 2207635 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CTCGCAAACTCCAAATTGGTTTCTCTTTCGCGTTCTCAATGCACTTGGATGGACACGAAAATTAATATTACAGTTAGACCTTATACTTTATTTGTAACTTTGTTGTATTTATCTATGCTTGTAATTGGTGTACAGTATTTGTTCTTTTTACAGTCTGTTCACTTGCCTTTAATAATGTATTAGTTAGGCTAGTAGTTTCTGCTGTGGTATCGGAGTAGTTAAAGTGGGCTAAGTAATAAATGCAAAGTTACCC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU26861 lncRNA upstream 6169 2200694 ~ 2200936 (+) True G23787
TU26830 lncRNA upstream 67237 2139545 ~ 2139868 (+) True G23771
TU26829 lncRNA upstream 67561 2139288 ~ 2139544 (+) True G23770
TU26355 lncRNA upstream 159254 2029532 ~ 2047851 (+) True G23356
TU26384 lncRNA upstream 227512 1979029 ~ 1979593 (+) True G23383
TU26953 lncRNA downstream 82711 2290346 ~ 2291021 (+) True G23871
TU26976 lncRNA downstream 245943 2453578 ~ 2454181 (+) True G23893
TU26984 lncRNA downstream 247374 2455009 ~ 2456866 (+) True G23898
TU26999 lncRNA downstream 253199 2460834 ~ 2461099 (+) True G23913
TU27007 lncRNA downstream 271452 2479087 ~ 2479378 (+) True G23921
CI01000003_02175343_02190917.mRNA mRNA upstream 13785 2174790 ~ 2193320 (+) True CI01000003_02175343_02190917
CI01000003_02101903_02151773.mRNA mRNA upstream 55129 2100815 ~ 2151976 (+) True CI01000003_02101903_02151773
CI01000003_02070747_02072861.mRNA mRNA upstream 133716 2070747 ~ 2073389 (+) True CI01000003_02070747_02072861
CI01000003_01982406_01992219.mRNA mRNA upstream 214261 1982336 ~ 1992844 (+) True CI01000003_01982406_01992219
CI01000003_01969544_01973134.mRNA mRNA upstream 233971 1969330 ~ 1973134 (+) True CI01000003_01969544_01973134
CI01000003_02259112_02344710.mRNA mRNA downstream 51477 2259112 ~ 2344710 (+) True CI01000003_02259112_02344710
CI01000003_02422051_02446833.mRNA mRNA downstream 214416 2422051 ~ 2446837 (+) True CI01000003_02422051_02446833
CI01000003_02466819_02469433.mRNA mRNA downstream 259184 2466819 ~ 2469631 (+) True CI01000003_02466819_02469433
CI01000003_02510102_02514782.mRNA mRNA downstream 302467 2510102 ~ 2514969 (+) True CI01000003_02510102_02514782
CI01000003_02534151_02541110.mRNA mRNA downstream 326516 2534151 ~ 2541444 (+) True CI01000003_02534151_02541110
TU26311 other upstream 338968 1863892 ~ 1866921 (+) False G23315
TU26312 other upstream 338968 1864690 ~ 1866921 (+) True G23315
TU26310 other upstream 338968 1864608 ~ 1866921 (+) True G23315
TU25485 other upstream 1281857 924803 ~ 925248 (+) True G22578
TU25360 other upstream 1811891 391013 ~ 395214 (+) True CI01000003_00390997_00406970
TU26952 other downstream 73025 2280660 ~ 2285641 (+) True G23870

Expression Profile


TU26864 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

TU26864 Expression in each Bioproject

Bar chart with 42 bars.
TU26864 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.