RNA id: TU26999



Basic Information


Item Value
RNA id TU26999
length 266
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G23913
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 2460834 ~ 2461099 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GTACAGTAGTGGTAGCACAATATGATATAGCATTAATCGTTAGAACAAGTATAAATCGATAGCGAAAAATGCTACTTATCAGATTGTGCTTTATTAATGTCTACACCTACCCCAACACTAAACCTACCCTTACAATAATGCAAATACAGTAATTTTGTGTTATTTATCATGACAAAAATGATGTAATATTGATGTGCGCACGTGCAGTAAGCCAGGGTATAGGACAATCTGACGGGTAGGACGAAATGTCAGGACACCGGGACGGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU26984 lncRNA upstream 3968 2455009 ~ 2456866 (+) True G23898
TU26976 lncRNA upstream 6653 2453578 ~ 2454181 (+) True G23893
TU26953 lncRNA upstream 169813 2290346 ~ 2291021 (+) True G23871
TU26864 lncRNA upstream 253199 2207105 ~ 2207635 (+) True G23789
TU26861 lncRNA upstream 259898 2200694 ~ 2200936 (+) True G23787
TU27007 lncRNA downstream 17988 2479087 ~ 2479378 (+) True G23921
TU27011 lncRNA downstream 29624 2490723 ~ 2491060 (+) True G23925
TU27013 lncRNA downstream 39556 2500655 ~ 2500879 (+) True G23927
TU27136 lncRNA downstream 102810 2563909 ~ 2564426 (+) True G24032
TU27165 lncRNA downstream 153987 2615086 ~ 2615402 (+) True G24058
CI01000003_02422051_02446833.mRNA mRNA upstream 13997 2422051 ~ 2446837 (+) True CI01000003_02422051_02446833
CI01000003_02259112_02344710.mRNA mRNA upstream 116124 2259112 ~ 2344710 (+) True CI01000003_02259112_02344710
CI01000003_02175343_02190917.mRNA mRNA upstream 267514 2174790 ~ 2193320 (+) True CI01000003_02175343_02190917
CI01000003_02101903_02151773.mRNA mRNA upstream 308858 2100815 ~ 2151976 (+) True CI01000003_02101903_02151773
CI01000003_02070747_02072861.mRNA mRNA upstream 387445 2070747 ~ 2073389 (+) True CI01000003_02070747_02072861
CI01000003_02466819_02469433.mRNA mRNA downstream 5720 2466819 ~ 2469631 (+) True CI01000003_02466819_02469433
CI01000003_02510102_02514782.mRNA mRNA downstream 49003 2510102 ~ 2514969 (+) True CI01000003_02510102_02514782
CI01000003_02534151_02541110.mRNA mRNA downstream 73052 2534151 ~ 2541444 (+) True CI01000003_02534151_02541110
CI01000003_02551541_02556812.mRNA mRNA downstream 90442 2551541 ~ 2556836 (+) True CI01000003_02551541_02556812
CI01000003_02781537_02783192.mRNA mRNA downstream 320334 2781433 ~ 2783270 (+) True CI01000003_02781537_02783192
TU26952 other upstream 175193 2280660 ~ 2285641 (+) True G23870
TU26311 other upstream 592697 1863892 ~ 1866921 (+) False G23315
TU26312 other upstream 592697 1864690 ~ 1866921 (+) True G23315
TU26310 other upstream 592697 1864608 ~ 1866921 (+) True G23315
TU25485 other upstream 1535586 924803 ~ 925248 (+) True G22578

Expression Profile


TU26999 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU26999 Expression in each Bioproject

Bar chart with 39 bars.
TU26999 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.