RNA id: TU27007



Basic Information


Item Value
RNA id TU27007
length 292
lncRNA type inter_gene
GC content 0.34
exon number 1
gene id G23921
representative True

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 2479087 ~ 2479378 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GAGGAGCTTTTATTATGCTTATGCTGCAGTCGGCCACTTCCAGTTTTTTCTTTGCATTTGTGGGGTAATGCAGTGCTGTTTTAGATGGTTAGAACAAGCATAAATACTTGTTTTACTTTGCAGTAACCTAGATCGATATTAGAATGTCATATTAATAAAAACTGGATGACTTGTGTTGCTAAATGACATGCAATTAATTAAAAAATATATTACATGATGGAAAAAGCTCTCTCTACTTTTGCTATGTTAGCCACTTGACAAAATAGTGCTGTCTCTGAGGCATGGTAAAAAT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU26999 lncRNA upstream 17988 2460834 ~ 2461099 (+) True G23913
TU26984 lncRNA upstream 22221 2455009 ~ 2456866 (+) True G23898
TU26976 lncRNA upstream 24906 2453578 ~ 2454181 (+) True G23893
TU26953 lncRNA upstream 188066 2290346 ~ 2291021 (+) True G23871
TU26864 lncRNA upstream 271452 2207105 ~ 2207635 (+) True G23789
TU27011 lncRNA downstream 11345 2490723 ~ 2491060 (+) True G23925
TU27013 lncRNA downstream 21277 2500655 ~ 2500879 (+) True G23927
TU27136 lncRNA downstream 84531 2563909 ~ 2564426 (+) True G24032
TU27165 lncRNA downstream 135708 2615086 ~ 2615402 (+) True G24058
TU27191 lncRNA downstream 176485 2655863 ~ 2656066 (+) True G24083
CI01000003_02466819_02469433.mRNA mRNA upstream 9456 2466819 ~ 2469631 (+) True CI01000003_02466819_02469433
CI01000003_02422051_02446833.mRNA mRNA upstream 32250 2422051 ~ 2446837 (+) True CI01000003_02422051_02446833
CI01000003_02259112_02344710.mRNA mRNA upstream 134377 2259112 ~ 2344710 (+) True CI01000003_02259112_02344710
CI01000003_02175343_02190917.mRNA mRNA upstream 285767 2174790 ~ 2193320 (+) True CI01000003_02175343_02190917
CI01000003_02101903_02151773.mRNA mRNA upstream 327111 2100815 ~ 2151976 (+) True CI01000003_02101903_02151773
CI01000003_02510102_02514782.mRNA mRNA downstream 30724 2510102 ~ 2514969 (+) True CI01000003_02510102_02514782
CI01000003_02534151_02541110.mRNA mRNA downstream 54773 2534151 ~ 2541444 (+) True CI01000003_02534151_02541110
CI01000003_02551541_02556812.mRNA mRNA downstream 72163 2551541 ~ 2556836 (+) True CI01000003_02551541_02556812
CI01000003_02781537_02783192.mRNA mRNA downstream 302055 2781433 ~ 2783270 (+) True CI01000003_02781537_02783192
TU26952 other upstream 193446 2280660 ~ 2285641 (+) True G23870
TU26311 other upstream 610950 1863892 ~ 1866921 (+) False G23315
TU26312 other upstream 610950 1864690 ~ 1866921 (+) True G23315
TU26310 other upstream 610950 1864608 ~ 1866921 (+) True G23315
TU25485 other upstream 1553839 924803 ~ 925248 (+) True G22578

Expression Profile


TU27007 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU27007 Expression in each Bioproject

Bar chart with 35 bars.
TU27007 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.