RNA id: CI01000004_01426795_01429440.mRNA



Basic Information


Item Value
RNA id CI01000004_01426795_01429440.mRNA
length 459
RNA type mRNA
GC content 0.48
exon number 4
gene id CI01000004_01426795_01429440
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 1426795 ~ 1429440 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


ATGGTAGAAATAGATGAGGATCCCCAGTTGGGGTTTGATTCTGACGAAGACGACGATGAATTATCAGACGGCGAGCTCCAAGAAGCCTTCGCCACGGGTTTGCTTAAACCTGGATTGAATATTCCTCTGGATAAGCCAAAGCAAGCCATCAACAATGTGGAGGGTTTGAAGAAATCCCTTGCTGAGTTTAAGAAGAGCCTTCCATGGGCTGAAAGGCTTGACCTCACCAACCAGCCAGCTGTTGACATCATTGCAAAAGCAGAGGGCAAACAACAACAATCAGAAGGCAGTGAAGACATCAATGCAGAGGATGACTTTCAGAGGGAGATGTACTTCTACCGACAGGCCCAAGCAACTGTTTTATTGGCGCTGCCAAAGCTGCATAAGCTCAAGATTCCTACCAAGCGACCTGAGGATTACTTTGCAGAGATGGCGAAGACCGATCAGCACATGCAGAAG

Function


GO:

id name namespace
GO:0034399 nuclear periphery cellular_component

KEGG:

id description
K14823 EBP2, EBNA1BP2; rRNA-processing protein EBP2

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU28366 lncRNA upstream 115204 1311043 ~ 1311591 (+) True G25143
TU28351 lncRNA upstream 136117 1290222 ~ 1290678 (+) True G25129
TU28283 lncRNA upstream 190401 1231735 ~ 1231938 (+) True G25063
TU28296 lncRNA upstream 266365 1140627 ~ 1160430 (+) True G25076
TU28310 lncRNA upstream 294218 1132293 ~ 1132577 (+) True G25089
TU28452 lncRNA downstream 15625 1445065 ~ 1445396 (+) True G25222
TU28431 lncRNA downstream 29893 1465948 ~ 1489877 (+) True G25201
TU28456 lncRNA downstream 141179 1570619 ~ 1570878 (+) True G25226
TU28422 lncRNA downstream 155826 1585266 ~ 1585620 (+) True G25192
TU28472 lncRNA downstream 274817 1704257 ~ 1704558 (+) True G25242
CI01000004_01377802_01389208.mRNA mRNA upstream 37380 1377685 ~ 1389415 (+) True CI01000004_01377802_01389208
CI01000004_01332533_01345585.mRNA mRNA upstream 80787 1331583 ~ 1346008 (+) False CI01000004_01332533_01345585
CI01000004_01321057_01329157.mRNA mRNA upstream 97638 1321057 ~ 1329157 (+) True CI01000004_01321057_01329157
CI01000004_01305065_01310559.mRNA mRNA upstream 116236 1305065 ~ 1310559 (+) True CI01000004_01305065_01310559
CI01000004_01302094_01304391.mRNA mRNA upstream 122131 1301149 ~ 1304664 (+) True CI01000004_01302094_01304391
CI01000004_01446583_01461259.mRNA mRNA downstream 16763 1446203 ~ 1461916 (+) False CI01000004_01446583_01461259
CI01000004_01501609_01545725.mRNA mRNA downstream 72169 1501609 ~ 1546119 (+) True CI01000004_01501609_01545725
CI01000004_01578642_01584658.mRNA mRNA downstream 149126 1578566 ~ 1584808 (+) True CI01000004_01578642_01584658
CI01000004_01592461_01602968.mRNA mRNA downstream 162916 1592356 ~ 1602968 (+) True CI01000004_01592461_01602968
CI01000004_01623427_01625278.mRNA mRNA downstream 193987 1623427 ~ 1625340 (+) True CI01000004_01623427_01625278
TU28341 other upstream 78621 1347470 ~ 1348174 (+) True G25120
TU28378 other upstream 92806 1332465 ~ 1333989 (+) False CI01000004_01332533_01345585
TU27514 other upstream 954949 467843 ~ 471846 (+) True CI01000004_00467911_00469949
TU28416 other downstream 175102 1604542 ~ 1616470 (+) True G25187
TU28515 other downstream 434719 1864159 ~ 1873358 (+) True G25282
TU28564 other downstream 653617 2083057 ~ 2085707 (+) True G25329
TU29214 other downstream 1118635 2548075 ~ 2573049 (+) True G25882
TU29329 other downstream 1307096 2736536 ~ 2736768 (+) True G25992

Expression Profile


CI01000004_01426795_01429440.mRNA Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 500.
End of interactive chart.

CI01000004_01426795_01429440.mRNA Expression in each Bioproject

Bar chart with 44 bars.
CI01000004_01426795_01429440.mRNA Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.