RNA id: CI01000004_01855598_01856473.mRNA



Basic Information


Item Value
RNA id CI01000004_01855598_01856473.mRNA
length 712
RNA type mRNA
GC content 0.37
exon number 4
gene id CI01000004_01855598_01856473
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 1855351 ~ 1856524 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CTATATAAAACAAAATATATTCATTATATTGTGCATATTATTATGCACTACACTTTCATTTTATTACTGTGAAAATTAGTTTTCATATATATATATATATGTTGTTGTCTTTCTCCTCCTGACCACTGGGCGCCAGTGTCGAGTTTAGCAGCCGCATATTTTTTTATAGAAAACTACAGTGAGTGAAAAGCACGCGTGTGAAAGCTAATGATAACTAGAGAAAAATAACACGGTTTTATTTCTCAAAATGGTTCGTAAATTGAAATATCACGAGCAGAAACTCTTGAAGAAAGTTGATTTTATTAACTGGGAGGTTGACAATAATTTACACGAGGTTAAAATATTGAGGAGATACCGCATTGAGAAGAGGGAAGATTACACCAAATACAACAAACTTAGTCGAAATATCAGAGAGTTGGCACAGAAAATACGGGACTTGGACGAAAAAGATGGCTTCAGAGCTCAAAGTACAACCATTTTTTTGGAAAAGCTTTACAGTGTCGGTTTGATTCCCACCAAACAGAGTCTCTCCCTTGCAAATGAAGTCAGTGCATCTGCATTCTGCAGGAGACGGCTTCCCACAATCATGACGAAACTGCGTATGGCTCCGAGCCTTAAGGTTGCCACAACCTTCATCGAGCAGGGCCGTATCCTTCAGTGAGAATATGTGTACTTCATATTCTTAAGTGTTGTAACATTTTAGTGTATAGAA

Function


GO:

id name namespace
GO:0032040 small-subunit processome cellular_component

KEGG:

id description
K14560 IMP3; U3 small nucleolar ribonucleoprotein protein IMP3

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU28484 lncRNA upstream 84647 1770395 ~ 1770704 (+) True G25254
TU28483 lncRNA upstream 85174 1769825 ~ 1770177 (+) True G25253
TU28478 lncRNA upstream 93088 1760530 ~ 1762263 (+) True G25248
TU28479 lncRNA upstream 96129 1757912 ~ 1759222 (+) True G25249
TU28472 lncRNA upstream 150793 1704257 ~ 1704558 (+) True G25242
TU28572 lncRNA downstream 89402 1945926 ~ 1950133 (+) True G25337
TU28579 lncRNA downstream 98861 1955385 ~ 1955605 (+) True G25344
TU28580 lncRNA downstream 99618 1956142 ~ 1956492 (+) True G25345
TU28559 lncRNA downstream 100118 1956642 ~ 1957261 (+) True G25324
TU28540 lncRNA downstream 102129 1958653 ~ 1959840 (+) True G25305
CI01000004_01823571_01825813.mRNA mRNA upstream 28585 1823571 ~ 1826766 (+) True CI01000004_01823571_01825813
CI01000004_01800502_01807872.mRNA mRNA upstream 46499 1800502 ~ 1808852 (+) True CI01000004_01800502_01807872
CI01000004_01757017_01757201.mRNA mRNA upstream 97487 1757017 ~ 1757864 (+) False CI01000004_01757017_01757201
CI01000004_01750322_01754593.mRNA mRNA upstream 100028 1750322 ~ 1755323 (+) True CI01000004_01750322_01754593
CI01000004_01715623_01744133.mRNA mRNA upstream 111218 1715623 ~ 1744133 (+) True CI01000004_01715623_01744133
CI01000004_01867166_01868986.mRNA mRNA downstream 10642 1867166 ~ 1868986 (+) False CI01000004_01867166_01868986
CI01000004_01883020_01908403.mRNA mRNA downstream 26496 1883020 ~ 1908634 (+) True CI01000004_01883020_01908403
CI01000004_01917089_01920203.mRNA mRNA downstream 59102 1915626 ~ 1920705 (+) True CI01000004_01917089_01920203
CI01000004_01937296_01943730.mRNA mRNA downstream 80772 1937296 ~ 1943730 (+) True CI01000004_01937296_01943730
CI01000004_01961480_01979407.mRNA mRNA downstream 103531 1960055 ~ 1979465 (+) False CI01000004_01961480_01979407
TU28416 other upstream 238881 1604542 ~ 1616470 (+) True G25187
TU28341 other upstream 507177 1347470 ~ 1348174 (+) True G25120
TU28378 other upstream 521362 1332465 ~ 1333989 (+) False CI01000004_01332533_01345585
TU27514 other upstream 1383505 467843 ~ 471846 (+) True CI01000004_00467911_00469949
TU28515 other downstream 7635 1864159 ~ 1873358 (+) True G25282
TU28564 other downstream 226533 2083057 ~ 2085707 (+) True G25329
TU29214 other downstream 691551 2548075 ~ 2573049 (+) True G25882
TU29329 other downstream 880012 2736536 ~ 2736768 (+) True G25992
TU29335 other downstream 901932 2758456 ~ 2758938 (+) True CI01000004_02745885_02768971

Expression Profile


CI01000004_01855598_01856473.mRNA Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 125.
End of interactive chart.

CI01000004_01855598_01856473.mRNA Expression in each Bioproject

Bar chart with 44 bars.
CI01000004_01855598_01856473.mRNA Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Homologous


species RNA id representative length rna type GC content exon number chromosome id location
zebrafish (Danio rerio) TCONS_00031932 True 576 mRNA 0.41 6 NC_007113.7 9983985 ~ 9989919 (-)