RNA id: CI01000004_01867166_01868986.mRNA



Basic Information


Item Value
RNA id CI01000004_01867166_01868986.mRNA
length 381
RNA type mRNA
GC content 0.42
exon number 5
gene id CI01000004_01867166_01868986
representative False

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 1867166 ~ 1868986 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TTCATCCCACCATTTCTAGTCTCTATTTCTAATGACATGCAATCTGACCTGAGATCAGGCCTCACTCCTGCACATAAACTAAATGGACGATGTCCAAACACCCCAGCATCCACTGCTGAGTGGGAATACAGTATATTAAAAATCAGTTTTTACAGCCCTATTAGTGTAAATGAGTACAAACTGAAAGGAGTTGAGAAGGTGAAGTACATGCATGGAGAAGAAGAGCGGACGAACACACGAAACCAAGAGAACTTGGAAAAGACCACATTTTTGCACAAGGGCAGGCATAAAGATGCCACCGGAAATAGTAATAAGATAAGTATCCACTCTTCAGAGAGCCAACAGGAGTTCTTCAGGATGCTGGATGAGAAGATTGAAAAG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU28484 lncRNA upstream 96462 1770395 ~ 1770704 (+) True G25254
TU28483 lncRNA upstream 96989 1769825 ~ 1770177 (+) True G25253
TU28478 lncRNA upstream 104903 1760530 ~ 1762263 (+) True G25248
TU28479 lncRNA upstream 107944 1757912 ~ 1759222 (+) True G25249
TU28472 lncRNA upstream 162608 1704257 ~ 1704558 (+) True G25242
TU28572 lncRNA downstream 76940 1945926 ~ 1950133 (+) True G25337
TU28579 lncRNA downstream 86399 1955385 ~ 1955605 (+) True G25344
TU28580 lncRNA downstream 87156 1956142 ~ 1956492 (+) True G25345
TU28559 lncRNA downstream 87656 1956642 ~ 1957261 (+) True G25324
TU28540 lncRNA downstream 89667 1958653 ~ 1959840 (+) True G25305
CI01000004_01855598_01856473.mRNA mRNA upstream 10642 1855351 ~ 1856524 (+) True CI01000004_01855598_01856473
CI01000004_01823571_01825813.mRNA mRNA upstream 40400 1823571 ~ 1826766 (+) True CI01000004_01823571_01825813
CI01000004_01800502_01807872.mRNA mRNA upstream 58314 1800502 ~ 1808852 (+) True CI01000004_01800502_01807872
CI01000004_01757017_01757201.mRNA mRNA upstream 109302 1757017 ~ 1757864 (+) False CI01000004_01757017_01757201
CI01000004_01750322_01754593.mRNA mRNA upstream 111843 1750322 ~ 1755323 (+) True CI01000004_01750322_01754593
CI01000004_01883020_01908403.mRNA mRNA downstream 14034 1883020 ~ 1908634 (+) True CI01000004_01883020_01908403
CI01000004_01917089_01920203.mRNA mRNA downstream 46640 1915626 ~ 1920705 (+) True CI01000004_01917089_01920203
CI01000004_01937296_01943730.mRNA mRNA downstream 68310 1937296 ~ 1943730 (+) True CI01000004_01937296_01943730
CI01000004_01961480_01979407.mRNA mRNA downstream 91069 1960055 ~ 1979465 (+) False CI01000004_01961480_01979407
CI01000004_01999847_02001406.mRNA mRNA downstream 130861 1999847 ~ 2002779 (+) True CI01000004_01999847_02001406
TU28416 other upstream 250696 1604542 ~ 1616470 (+) True G25187
TU28341 other upstream 518992 1347470 ~ 1348174 (+) True G25120
TU28378 other upstream 533177 1332465 ~ 1333989 (+) False CI01000004_01332533_01345585
TU27514 other upstream 1395320 467843 ~ 471846 (+) True CI01000004_00467911_00469949
TU28564 other downstream 214071 2083057 ~ 2085707 (+) True G25329
TU29214 other downstream 679089 2548075 ~ 2573049 (+) True G25882
TU29329 other downstream 867550 2736536 ~ 2736768 (+) True G25992
TU29335 other downstream 889470 2758456 ~ 2758938 (+) True CI01000004_02745885_02768971
TU29632 other downstream 1640031 3509017 ~ 3522393 (+) True G26245

Expression Profile


CI01000004_01867166_01868986.mRNA Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

CI01000004_01867166_01868986.mRNA Expression in each Bioproject

Bar chart with 35 bars.
CI01000004_01867166_01868986.mRNA Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.