RNA id: TU28565



Basic Information


Item Value
RNA id TU28565
length 209
lncRNA type sense_over
GC content 0.38
exon number 1
gene id CI01000004_02068075_02072887
representative False

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 2067958 ~ 2074081 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TAGTGATGGCCGATTTCAAAACACTGCTTCATGAAGCTTCGGAGCGTTATGAATCGGCGTTATGAATCAGCGTGTCGAATCAGCGGTTTGGAGCGCCAAAGTCATGTGATTTCAGCAATTTGGCGGTTTGACACGCGATCCGAATCATGATTTGACACAAAAGATTCATAACGCTCCGAAGCTTAATGAAGCAGTGTTTTGAAATCGGC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU28532 lncRNA upstream 45486 1978730 ~ 2027792 (+) True G25297
TU28540 lncRNA upstream 112219 1958653 ~ 1959840 (+) True G25305
TU28559 lncRNA upstream 116017 1956642 ~ 1957261 (+) True G25324
TU28580 lncRNA upstream 116786 1956142 ~ 1956492 (+) True G25345
TU28579 lncRNA upstream 117673 1955385 ~ 1955605 (+) True G25344
TU28547 lncRNA downstream 236 2073722 ~ 2074081 (+) True CI01000004_02068075_02072887
TU28567 lncRNA downstream 1433 2074919 ~ 2081442 (+) True G25332
TU28593 lncRNA downstream 12273 2085759 ~ 2122591 (+) True G25358
TU28560 lncRNA downstream 65432 2138918 ~ 2139139 (+) True G25325
TU28536 lncRNA downstream 65892 2139378 ~ 2140889 (+) True G25301
CI01000004_02033826_02057420.mRNA mRNA upstream 15625 2033003 ~ 2057653 (+) True CI01000004_02033826_02057420
CI01000004_02014703_02018248.mRNA mRNA upstream 54812 2014600 ~ 2018466 (+) True CI01000004_02014703_02018248
CI01000004_02004004_02012588.mRNA mRNA upstream 59864 2002871 ~ 2013414 (+) True CI01000004_02004004_02012588
CI01000004_01999847_02001406.mRNA mRNA upstream 70499 1999847 ~ 2002779 (+) True CI01000004_01999847_02001406
CI01000004_01961480_01979407.mRNA mRNA upstream 93813 1960055 ~ 1979465 (+) False CI01000004_01961480_01979407
CI01000004_02116310_02120268.mRNA mRNA downstream 42451 2115937 ~ 2120360 (+) True CI01000004_02116310_02120268
CI01000004_02126757_02136937.mRNA mRNA downstream 52980 2126466 ~ 2137348 (+) True CI01000004_02126757_02136937
CI01000004_02143355_02186281.mRNA mRNA downstream 69190 2142676 ~ 2186771 (+) True CI01000004_02143355_02186281
CI01000004_02528689_02568243.mRNA mRNA downstream 455203 2528689 ~ 2569227 (+) True CI01000004_02528689_02568243
CI01000004_02671199_02727898.mRNA mRNA downstream 597713 2671199 ~ 2728328 (+) True CI01000004_02671199_02727898
TU28515 other upstream 199920 1864159 ~ 1873358 (+) True G25282
TU28416 other upstream 456808 1604542 ~ 1616470 (+) True G25187
TU28341 other upstream 725104 1347470 ~ 1348174 (+) True G25120
TU28378 other upstream 739289 1332465 ~ 1333989 (+) False CI01000004_01332533_01345585
TU27514 other upstream 1601432 467843 ~ 471846 (+) True CI01000004_00467911_00469949
TU28564 other downstream 9571 2083057 ~ 2085707 (+) True G25329
TU29214 other downstream 474589 2548075 ~ 2573049 (+) True G25882
TU29329 other downstream 663050 2736536 ~ 2736768 (+) True G25992
TU29335 other downstream 684970 2758456 ~ 2758938 (+) True CI01000004_02745885_02768971
TU29632 other downstream 1435531 3509017 ~ 3522393 (+) True G26245

Expression Profile


TU28565 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 75.
End of interactive chart.

TU28565 Expression in each Bioproject

Bar chart with 32 bars.
TU28565 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.