RNA id: TU29335



Basic Information


Item Value
RNA id TU29335
length 340
RNA type TUCP
GC content 0.39
exon number 2
gene id CI01000004_02745885_02768971
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 2745885 ~ 2769135 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GTTTTTGTTTGTATCTCCTCAAGGTACCATGGTCATAGATGTGCAGGAAACAAACATTCCATCCAGTTTAGAACCATCTCTCTCAAATGAAACAAATATATCTGAGACCAGAAGAGCAAACATTCCTGTTATAGAAGTGCCTGATTCACCTTCCTTTCAGACTGGCAATCTGCTCAGCGATCAGTCAAAGAGTCCATGTCAGCCTTTCAGTGGAGATGAATGCAGCAATGGTTACGTTAAGGGATATCCCCCAAATTTACCCTACATCGGAAGCTCACTGATACTTTGCCACTTACGGAAAGAGAAAACGCCCAAATGTTGTATGCAGCTGGAAAAGGTA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU29216 lncRNA upstream 112794 2644190 ~ 2645662 (+) True G25884
TU29246 lncRNA upstream 145988 2611213 ~ 2612468 (+) True G25914
TU29217 lncRNA upstream 231628 2482508 ~ 2526828 (+) True G25885
TU29201 lncRNA upstream 276099 2474371 ~ 2482357 (+) True G25871
TU29204 lncRNA upstream 284262 2459864 ~ 2474194 (+) True G25873
TU29365 lncRNA downstream 12703 2771641 ~ 2771878 (+) True G26014
TU29366 lncRNA downstream 15367 2774305 ~ 2774560 (+) True G26015
TU29369 lncRNA downstream 16632 2775570 ~ 2775846 (+) False G26017
TU29370 lncRNA downstream 16632 2775570 ~ 2775981 (+) True G26017
TU29318 lncRNA downstream 17431 2776369 ~ 2777255 (+) True G25982
CI01000004_02671199_02727898.mRNA mRNA upstream 30128 2671199 ~ 2728328 (+) True CI01000004_02671199_02727898
CI01000004_02528689_02568243.mRNA mRNA upstream 189229 2528689 ~ 2569227 (+) True CI01000004_02528689_02568243
CI01000004_02143355_02186281.mRNA mRNA upstream 571685 2142676 ~ 2186771 (+) True CI01000004_02143355_02186281
CI01000004_02126757_02136937.mRNA mRNA upstream 621108 2126466 ~ 2137348 (+) True CI01000004_02126757_02136937
CI01000004_02116310_02120268.mRNA mRNA upstream 638096 2115937 ~ 2120360 (+) True CI01000004_02116310_02120268
CI01000004_02865415_02867952.mRNA mRNA downstream 105915 2864853 ~ 2868369 (+) True CI01000004_02865415_02867952
CI01000004_02903759_02904287.mRNA mRNA downstream 144821 2903759 ~ 2904324 (+) True CI01000004_02903759_02904287
CI01000004_02906581_02908320.mRNA mRNA downstream 147541 2906479 ~ 2908320 (+) True CI01000004_02906581_02908320
CI01000004_02948465_02951235.mRNA mRNA downstream 188278 2947216 ~ 2951743 (+) True CI01000004_02948465_02951235
CI01000004_02955707_02959931.mRNA mRNA downstream 196592 2955530 ~ 2959931 (+) True CI01000004_02955707_02959931
TU29329 other upstream 21688 2736536 ~ 2736768 (+) True G25992
TU29214 other upstream 185407 2548075 ~ 2573049 (+) True G25882
TU28564 other upstream 672749 2083057 ~ 2085707 (+) True G25329
TU28515 other upstream 885098 1864159 ~ 1873358 (+) True G25282
TU28416 other upstream 1141986 1604542 ~ 1616470 (+) True G25187
TU29632 other downstream 750079 3509017 ~ 3522393 (+) True G26245
TU29692 other downstream 792110 3551048 ~ 3552446 (+) True CI01000004_03550525_03552621
TU31414 other downstream 2613887 5372825 ~ 5373803 (+) False G27805
TU31416 other downstream 2613887 5372825 ~ 5373803 (+) False G27805
TU31417 other downstream 2613887 5372825 ~ 5373803 (+) False G27805

Expression Profile


TU29335 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU29335 Expression in each Bioproject

Bar chart with 9 bars.
TU29335 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 70.
End of interactive chart.