RNA id: TU28990


Basic Information

Item Value
RNA id TU28990
length 560
lncRNA type intronic
GC content 0.41
exon number 1
gene id G25688
representative True

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 1681971 ~ 1682530 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence

AAAAATCAAACTTCAAATACATAAATCCTACAGGCGTCACACATGAACACTGATTAACCAGATTTTGGCATGTACACACTGACATTGCACATTTTCAGCAGGCCTACTTTCATGCTGAACCTGCAGATCTGATACAATTACACAAGTAGACAAGTTGATTATTAGACTCAAATGTCATGAGATGTTTCACAATTTCCCTTTCGCCCAACCCCATGACGTACATCAGCAGTAAGTGAATGTTGAGACTCTTTACCATTGACCTTTAAGAAGTCAAACCTTCCTTGCTAAGGTTTACAGAGCATCTGACTTTCTGTTTGATTGGCCTACCGTTTGATTCTCTTTACAAAAGACCATAGTGTAGATTTACCCAGCATCCCCTCCGTCCCACAAAACCACCTCTGTGAGAGCGTTTGGCCGTTCCAGCAGCCCCTCCTCCCCTTTCCATCATACACTGCCCCTCTCTGTGTCCTCGTGTCCCCAGCCGCACCGTTGATATATGGGCCAGGTTTTCCTGATTTCACCCATAAAGAGGCAAAGAGTCGACGGCTTCTCGTTTCGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

JBrowse2

Loading

Neighbor

RNA id RNA type direction distance location representative gene id
TU28844 lncRNA downstream 11989 1629346 ~ 1669982 (-) True G25559
TU28914 lncRNA downstream 17918 1649988 ~ 1664053 (-) True G25625
TU28855 lncRNA downstream 78680 1602784 ~ 1603291 (-) True G25569
TU28903 lncRNA downstream 85958 1592380 ~ 1596013 (-) True G25615
TU28901 lncRNA downstream 91116 1590620 ~ 1590855 (-) True G25613
TU29000 lncRNA upstream 843 1683373 ~ 1684639 (-) False G25689
TU28996 lncRNA upstream 1294 1683824 ~ 1684639 (-) True G25689
TU28987 lncRNA upstream 2642 1685172 ~ 1686208 (-) True G25687
TU28972 lncRNA upstream 6829 1689359 ~ 1690837 (-) True G25672
TU29001 lncRNA upstream 8764 1691294 ~ 1692061 (-) True G25690
CI01000004_01626984_01627238.mRNA mRNA downstream 54733 1626216 ~ 1627238 (-) True CI01000004_01626984_01627238
CI01000004_01605140_01622364.mRNA mRNA downstream 59607 1604552 ~ 1622364 (-) True CI01000004_01605140_01622364
CI01000004_01554696_01564701.mRNA mRNA downstream 117270 1554656 ~ 1564701 (-) True CI01000004_01554696_01564701
CI01000004_01440447_01443088.mRNA mRNA downstream 238679 1439771 ~ 1443292 (-) True CI01000004_01440447_01443088
CI01000004_01404265_01425424.mRNA mRNA downstream 256547 1404265 ~ 1425424 (-) True CI01000004_01404265_01425424
CI01000004_01758554_01762415.mRNA mRNA upstream 75892 1758422 ~ 1762415 (-) True CI01000004_01758554_01762415
CI01000004_01773383_01774888.mRNA mRNA upstream 90398 1772928 ~ 1774942 (-) False CI01000004_01773383_01774888
CI01000004_01814534_01821755.mRNA mRNA upstream 131252 1813782 ~ 1821755 (-) True CI01000004_01814534_01821755
CI01000004_01833090_01839923.mRNA mRNA upstream 150484 1833014 ~ 1839923 (-) True CI01000004_01833090_01839923
CI01000004_01853673_01854481.mRNA mRNA upstream 170658 1853188 ~ 1855232 (-) True CI01000004_01853673_01854481
TU29027 other upstream 90510 1773040 ~ 1774941 (-) True CI01000004_01773383_01774888
TU30225 other upstream 1591903 3274433 ~ 3275721 (-) True G26788
TU31341 other upstream 3495697 5178227 ~ 5203724 (-) False G27746
TU31343 other upstream 3497463 5179993 ~ 5195103 (-) True G27746
TU31692 other upstream 3937853 5620383 ~ 5627514 (-) True CI01000004_05617072_05627369

Expression Profile

TU28990 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU28990 Expression in each Bioproject

Bar chart with 31 bars.
TU28990 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
eurasian perch (Perca fluviatilis) TU13050 True 249 lncRNA 0.45 1 NC_053112.1 34329717 ~ 34329965 (-)
tiger barb (Puntius tetrazona) TU13050 True 1010 lncRNA 0.44 2 NC_056700.1 2249222 ~ 2253591 (+)