RNA id: TU29365



Basic Information


Item Value
RNA id TU29365
length 238
lncRNA type inter_gene
GC content 0.41
exon number 1
gene id G26014
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 2771641 ~ 2771878 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TCCCGAGTCTTTAATTTTGCTGACGCGCATCAGTTCCTCTTTGAAGCTACATAAACTGATTAAATGACTAGTGGCAGGAGGCATCATGAGGCTGATTTTTTAAGATGCAGATAACCACTAACTGTGTGCAGGAAATGTTTAATGAGAGGAGTGTGTGAGGTGTTCCGGACTAAACTGATCTATTCCTGTCATAATATACACAGACAGTAAAGAAGATTTGGGTTTTGCCACACTGTTC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU29216 lncRNA upstream 125979 2644190 ~ 2645662 (+) True G25884
TU29246 lncRNA upstream 159173 2611213 ~ 2612468 (+) True G25914
TU29217 lncRNA upstream 244813 2482508 ~ 2526828 (+) True G25885
TU29201 lncRNA upstream 289284 2474371 ~ 2482357 (+) True G25871
TU29203 lncRNA upstream 297447 2459864 ~ 2474194 (+) False G25873
TU29366 lncRNA downstream 2427 2774305 ~ 2774560 (+) True G26015
TU29369 lncRNA downstream 3692 2775570 ~ 2775846 (+) False G26017
TU29370 lncRNA downstream 3692 2775570 ~ 2775981 (+) True G26017
TU29318 lncRNA downstream 4491 2776369 ~ 2777255 (+) True G25982
TU29323 lncRNA downstream 5876 2777754 ~ 2779182 (+) True G25986
CI01000004_02745885_02768971.mRNA mRNA upstream 2506 2745885 ~ 2769135 (+) False CI01000004_02745885_02768971
CI01000004_02671199_02727898.mRNA mRNA upstream 43313 2671199 ~ 2728328 (+) True CI01000004_02671199_02727898
CI01000004_02528689_02568243.mRNA mRNA upstream 202414 2528689 ~ 2569227 (+) True CI01000004_02528689_02568243
CI01000004_02143355_02186281.mRNA mRNA upstream 584870 2142676 ~ 2186771 (+) True CI01000004_02143355_02186281
CI01000004_02126757_02136937.mRNA mRNA upstream 634293 2126466 ~ 2137348 (+) True CI01000004_02126757_02136937
CI01000004_02865415_02867952.mRNA mRNA downstream 92975 2864853 ~ 2868369 (+) True CI01000004_02865415_02867952
CI01000004_02903759_02904287.mRNA mRNA downstream 131881 2903759 ~ 2904324 (+) True CI01000004_02903759_02904287
CI01000004_02906581_02908320.mRNA mRNA downstream 134601 2906479 ~ 2908320 (+) True CI01000004_02906581_02908320
CI01000004_02948465_02951235.mRNA mRNA downstream 175338 2947216 ~ 2951743 (+) True CI01000004_02948465_02951235
CI01000004_02955707_02959931.mRNA mRNA downstream 183652 2955530 ~ 2959931 (+) True CI01000004_02955707_02959931
TU29335 other upstream 12703 2758456 ~ 2758938 (+) True CI01000004_02745885_02768971
TU29329 other upstream 34873 2736536 ~ 2736768 (+) True G25992
TU29214 other upstream 198592 2548075 ~ 2573049 (+) True G25882
TU28564 other upstream 685934 2083057 ~ 2085707 (+) True G25329
TU28515 other upstream 898283 1864159 ~ 1873358 (+) True G25282
TU29632 other downstream 737139 3509017 ~ 3522393 (+) True G26245
TU29692 other downstream 779170 3551048 ~ 3552446 (+) True CI01000004_03550525_03552621
TU31414 other downstream 2600947 5372825 ~ 5373803 (+) False G27805
TU31416 other downstream 2600947 5372825 ~ 5373803 (+) False G27805
TU31417 other downstream 2600947 5372825 ~ 5373803 (+) False G27805

Expression Profile


TU29365 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

TU29365 Expression in each Bioproject

Bar chart with 6 bars.
TU29365 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.