RNA id: TU29370



Basic Information


Item Value
RNA id TU29370
length 412
lncRNA type inter_gene
GC content 0.32
exon number 1
gene id G26017
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 2775570 ~ 2775981 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


AATTTACCAAAGCACAAAATAAGATATCCAGAATCCCCTCTGTAAAAGCCCTTTCATCTAATATGTCAACAAATAGAACCAAGAATTTTAAACCTGGACCTTTCCAATTTCCAGATTTTGTTTTTGGAAATGTATGCAAATGAGCGTATATTTAAGTATATAAGGCCTCATTTGCATATTAAAACATAAATTTACACAAAACTTGTAATACATTTTTTTCTTATGTTTATGCCAGTAATAAACTGGAGAAGTTTCACAGTGATATCTTCTAATTTAAAAAAAAAATCCCTATTCACCTGTAGTGTCTCGCCTAAGTAATACAAGTGAAGTGTCTAAATGCGGTCTTTGATTTTGCCCGCAAAATTTCACCAATCAACGGTAAATGTGACCTCACATGTAGAACATTCATCTC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU29366 lncRNA upstream 1010 2774305 ~ 2774560 (+) True G26015
TU29365 lncRNA upstream 3692 2771641 ~ 2771878 (+) True G26014
TU29216 lncRNA upstream 129908 2644190 ~ 2645662 (+) True G25884
TU29246 lncRNA upstream 163102 2611213 ~ 2612468 (+) True G25914
TU29217 lncRNA upstream 248742 2482508 ~ 2526828 (+) True G25885
TU29318 lncRNA downstream 388 2776369 ~ 2777255 (+) True G25982
TU29323 lncRNA downstream 1773 2777754 ~ 2779182 (+) True G25986
TU29320 lncRNA downstream 28170 2804151 ~ 2810327 (+) True G25983
TU29397 lncRNA downstream 53082 2829063 ~ 2829269 (+) True G26041
TU29398 lncRNA downstream 55668 2831649 ~ 2832043 (+) True G26042
CI01000004_02745885_02768971.mRNA mRNA upstream 6435 2745885 ~ 2769135 (+) False CI01000004_02745885_02768971
CI01000004_02671199_02727898.mRNA mRNA upstream 47242 2671199 ~ 2728328 (+) True CI01000004_02671199_02727898
CI01000004_02528689_02568243.mRNA mRNA upstream 206343 2528689 ~ 2569227 (+) True CI01000004_02528689_02568243
CI01000004_02143355_02186281.mRNA mRNA upstream 588799 2142676 ~ 2186771 (+) True CI01000004_02143355_02186281
CI01000004_02126757_02136937.mRNA mRNA upstream 638222 2126466 ~ 2137348 (+) True CI01000004_02126757_02136937
CI01000004_02865415_02867952.mRNA mRNA downstream 88872 2864853 ~ 2868369 (+) True CI01000004_02865415_02867952
CI01000004_02903759_02904287.mRNA mRNA downstream 127778 2903759 ~ 2904324 (+) True CI01000004_02903759_02904287
CI01000004_02906581_02908320.mRNA mRNA downstream 130498 2906479 ~ 2908320 (+) True CI01000004_02906581_02908320
CI01000004_02948465_02951235.mRNA mRNA downstream 171235 2947216 ~ 2951743 (+) True CI01000004_02948465_02951235
CI01000004_02955707_02959931.mRNA mRNA downstream 179549 2955530 ~ 2959931 (+) True CI01000004_02955707_02959931
TU29335 other upstream 16632 2758456 ~ 2758938 (+) True CI01000004_02745885_02768971
TU29329 other upstream 38802 2736536 ~ 2736768 (+) True G25992
TU29214 other upstream 202521 2548075 ~ 2573049 (+) True G25882
TU28564 other upstream 689863 2083057 ~ 2085707 (+) True G25329
TU28515 other upstream 902212 1864159 ~ 1873358 (+) True G25282
TU29632 other downstream 733036 3509017 ~ 3522393 (+) True G26245
TU29692 other downstream 775067 3551048 ~ 3552446 (+) True CI01000004_03550525_03552621
TU31414 other downstream 2596844 5372825 ~ 5373803 (+) False G27805
TU31416 other downstream 2596844 5372825 ~ 5373803 (+) False G27805
TU31417 other downstream 2596844 5372825 ~ 5373803 (+) False G27805

Expression Profile


TU29370 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU29370 Expression in each Bioproject

Bar chart with 37 bars.
TU29370 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.