RNA id: TU34813



Basic Information


Item Value
RNA id TU34813
length 373
RNA type TUCP
GC content 0.50
exon number 2
gene id G30797
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10497376 ~ 10497788 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GTCCCCTCAAAATAACTCAACACACAGCCATTAATGTCTAAACTGCTGGCCACAAAAGTGAGTCAATATTTTGTGTGGCCACCATTATTTTCCAGCACTGCCTTAACCCTCTTGGGCATGGAGTTCATCAGAGCTTCACAGGTTGCCACTGGAGTCCTCTTCCACTCCTCCATGACGACATCACGGAGCTGGTGGATGTTAGAGACCTTGCGCTCCTCCACCTTCCGTTTGAGGATGCCCCACAGATGCTCAATAGGGTTTAGGTCTGGAGACATGCTTGGCCAGTCCATCACCTTTACCCTCAGCTTCTTTAGCAAGGCAGTGGTCGTCTTGGAGGTGTGTTTGGGGTCGTTATCATGTTGGAATACTGCCC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU34802 lncRNA upstream 22425 10474750 ~ 10474951 (+) True G30787
TU34795 lncRNA upstream 43116 10453602 ~ 10454260 (+) True G30780
TU34700 lncRNA upstream 49639 10436230 ~ 10447737 (+) True G30688
TU34785 lncRNA upstream 64063 10433093 ~ 10433313 (+) True CI01000004_10434104_10435287
TU34693 lncRNA upstream 152398 10208466 ~ 10344978 (+) True G30681
TU34701 lncRNA downstream 196129 10693917 ~ 10697207 (+) True G30689
TU34864 lncRNA downstream 203436 10701224 ~ 10701436 (+) True G30839
TU34684 lncRNA downstream 234599 10732387 ~ 10735356 (+) False G30678
TU34686 lncRNA downstream 234599 10732387 ~ 10735643 (+) False G30678
TU34687 lncRNA downstream 234599 10732387 ~ 10736123 (+) False G30678
CI01000004_10434104_10435287.mRNA mRNA upstream 61807 10431833 ~ 10435569 (+) False CI01000004_10434104_10435287
CI01000004_10376389_10423302.mRNA mRNA upstream 74074 10376389 ~ 10423302 (+) True CI01000004_10376389_10423302
CI01000004_10169407_10212947.mRNA mRNA upstream 284187 10169407 ~ 10213189 (+) True CI01000004_10169407_10212947
CI01000004_10058538_10090881.mRNA mRNA upstream 406327 10058538 ~ 10091049 (+) True CI01000004_10058538_10090881
CI01000004_09980195_09995816.mRNA mRNA upstream 501483 9980195 ~ 9995893 (+) True CI01000004_09980195_09995816
CI01000004_10514814_10550774.mRNA mRNA downstream 17026 10514814 ~ 10550920 (+) True CI01000004_10514814_10550774
CI01000004_10582152_10586349.mRNA mRNA downstream 84333 10582121 ~ 10586553 (+) True CI01000004_10582152_10586349
CI01000004_10610634_10613290.mRNA mRNA downstream 111992 10609780 ~ 10613630 (+) True CI01000004_10610634_10613290
CI01000004_10630265_10647904.mRNA mRNA downstream 132477 10630265 ~ 10647904 (+) True CI01000004_10630265_10647904
CI01000004_10683400_10692323.mRNA mRNA downstream 185612 10683400 ~ 10692565 (+) True CI01000004_10683400_10692323
TU32792 other upstream 1516392 8976438 ~ 8980984 (+) False CI01000004_08976512_08980033
TU32793 other upstream 1516392 8976438 ~ 8980984 (+) True CI01000004_08976512_08980033
TU32637 other upstream 1897773 8599235 ~ 8599603 (+) True G28859
TU32590 other upstream 2046149 8439958 ~ 8451227 (+) True G28818
TU32454 other upstream 2840993 7654772 ~ 7654879 (+) True G28706
TU35938 other downstream 1139463 11637251 ~ 11642400 (+) True G31710
TU35811 other downstream 1166985 11664773 ~ 11665473 (+) False G31611
TU35813 other downstream 1166985 11664773 ~ 11665473 (+) True G31611
TU36123 other downstream 1694342 12192130 ~ 12195147 (+) False G31865
TU36655 other downstream 2144966 12642754 ~ 12655711 (+) True G32314

Expression Profile


TU34813 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU34813 Expression in each Bioproject

Bar chart with 42 bars.
TU34813 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.