RNA id: TU36249



Basic Information


Item Value
RNA id TU36249
length 209
lncRNA type inter_gene
GC content 0.29
exon number 1
gene id G31967
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12484698 ~ 12484906 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


TGTTTAACATTATATTAGATCCGTTTGGTACAGTAGGTCTTTATATATAGGCTGTCTGTTTCATTAATGTTAATCAAACAATTGTGGAATCATGGAAAAAAAGTTGAATATATATTTTTTCCTATAGATATGGGTTTTGACTTGGTTTGTTTCAAATTTGGTGGTATTACCAGGGATTTTAAGGTTTAAGGATTTTAATCGAATGTCCA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU36241 lncRNA upstream 11293 12473123 ~ 12473405 (+) True G31959
TU36233 lncRNA upstream 21324 12462530 ~ 12463374 (+) True G31952
TU36220 lncRNA upstream 88072 12396391 ~ 12396626 (+) True G31939
TU36209 lncRNA upstream 133216 12351282 ~ 12351482 (+) True G31930
TU36133 lncRNA upstream 179829 12302619 ~ 12304869 (+) True G31874
TU36251 lncRNA downstream 2027 12486933 ~ 12487443 (+) True G31969
TU36636 lncRNA downstream 16572 12501478 ~ 12501881 (+) True G32296
TU36699 lncRNA downstream 178673 12663579 ~ 12663812 (+) True G32350
TU36720 lncRNA downstream 215709 12700615 ~ 12700910 (+) True G32371
TU36736 lncRNA downstream 220058 12704964 ~ 12781485 (+) True G32382
CI01000004_12426409_12429382.mRNA mRNA upstream 55228 12426409 ~ 12429470 (+) True CI01000004_12426409_12429382
CI01000004_12422242_12423747.mRNA mRNA upstream 60005 12422080 ~ 12424693 (+) True CI01000004_12422242_12423747
CI01000004_12418456_12419641.mRNA mRNA upstream 63679 12417696 ~ 12421019 (+) True CI01000004_12418456_12419641
CI01000004_12412259_12417501.mRNA mRNA upstream 67181 12412135 ~ 12417517 (+) True CI01000004_12412259_12417501
CI01000004_12393203_12398519.mRNA mRNA upstream 85406 12392504 ~ 12399292 (+) True CI01000004_12393203_12398519
CI01000004_12553125_12559468.mRNA mRNA downstream 67868 12552774 ~ 12559876 (+) True CI01000004_12553125_12559468
CI01000004_12562823_12563491.mRNA mRNA downstream 76412 12561318 ~ 12563813 (+) True CI01000004_12562823_12563491
CI01000004_12594138_12621268.mRNA mRNA downstream 108257 12593163 ~ 12621791 (+) True CI01000004_12594138_12621268
CI01000004_12625701_12630744.mRNA mRNA downstream 139415 12624321 ~ 12630926 (+) True CI01000004_12625701_12630744
CI01000004_12646972_12652534.mRNA mRNA downstream 161932 12646838 ~ 12652570 (+) False CI01000004_12646972_12652534
TU36123 other upstream 289551 12192130 ~ 12195147 (+) False G31865
TU35811 other upstream 817039 11664773 ~ 11665473 (+) False G31611
TU35813 other upstream 817120 11664773 ~ 11665473 (+) True G31611
TU35938 other upstream 842298 11637251 ~ 11642400 (+) True G31710
TU34813 other upstream 1986910 10497376 ~ 10497788 (+) True G30797
TU36655 other downstream 157848 12642754 ~ 12655711 (+) True G32314
TU37521 other downstream 1538641 14023547 ~ 14031127 (+) True G33092
TU38554 other downstream 2606338 15091244 ~ 15091969 (+) True CI01000004_15091390_15096502
TU38784 other downstream 3454451 15939357 ~ 15939950 (+) True G34220
TU38340 other downstream 3578509 16063415 ~ 16066464 (+) True G33815

Expression Profile


TU36249 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU36249 Expression in each Bioproject

Bar chart with 33 bars.
TU36249 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.