RNA id: TU36636



Basic Information


Item Value
RNA id TU36636
length 404
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G32296
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12501478 ~ 12501881 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


AATCCACCATTTTGTCCAATAAAGCAGTCAGGGGAGTTAGTAGACTAACGTTGATGGACTTGAACTTGAAAAATTATGTGTACTGACGTCTTTCTGTGGTTGAAATGTGGTTCATTCATGTTTATTTGATGATATAAATGAACTAGTAAGAAGAGATGAGCCGCTTGATCTGAGGCGCTACAGCGATCTGTCACGACACATTAAAGAGCCACAAAACAGTATTTGTTTAAATTTCTTTAAAAATTACAAAATTTGAAATTTGAGACTTTGTTTCATATCAAAAGTAACCTGCTCTGTCTTGTCTGTCGATACGTTGTCAGTGTCCTCTTTGCTCTGCGATGTATTTTTCACTGCGTGAGAATATGATGTGTGTGAGAGCGGCATGGCTTGTCGGACATAGCAAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU36251 lncRNA upstream 14035 12486933 ~ 12487443 (+) True G31969
TU36249 lncRNA upstream 16572 12484698 ~ 12484906 (+) True G31967
TU36241 lncRNA upstream 28073 12473123 ~ 12473405 (+) True G31959
TU36233 lncRNA upstream 38104 12462530 ~ 12463374 (+) True G31952
TU36220 lncRNA upstream 104852 12396391 ~ 12396626 (+) True G31939
TU36699 lncRNA downstream 161698 12663579 ~ 12663812 (+) True G32350
TU36720 lncRNA downstream 198734 12700615 ~ 12700910 (+) True G32371
TU36736 lncRNA downstream 203083 12704964 ~ 12781485 (+) True G32382
TU36768 lncRNA downstream 307736 12809617 ~ 12810075 (+) True G32414
TU36785 lncRNA downstream 351081 12852962 ~ 12853804 (+) True G32431
CI01000004_12426409_12429382.mRNA mRNA upstream 72008 12426409 ~ 12429470 (+) True CI01000004_12426409_12429382
CI01000004_12422242_12423747.mRNA mRNA upstream 76785 12422080 ~ 12424693 (+) True CI01000004_12422242_12423747
CI01000004_12418456_12419641.mRNA mRNA upstream 80459 12417696 ~ 12421019 (+) True CI01000004_12418456_12419641
CI01000004_12412259_12417501.mRNA mRNA upstream 83961 12412135 ~ 12417517 (+) True CI01000004_12412259_12417501
CI01000004_12393203_12398519.mRNA mRNA upstream 102186 12392504 ~ 12399292 (+) True CI01000004_12393203_12398519
CI01000004_12553125_12559468.mRNA mRNA downstream 50893 12552774 ~ 12559876 (+) True CI01000004_12553125_12559468
CI01000004_12562823_12563491.mRNA mRNA downstream 59437 12561318 ~ 12563813 (+) True CI01000004_12562823_12563491
CI01000004_12594138_12621268.mRNA mRNA downstream 91282 12593163 ~ 12621791 (+) True CI01000004_12594138_12621268
CI01000004_12625701_12630744.mRNA mRNA downstream 122440 12624321 ~ 12630926 (+) True CI01000004_12625701_12630744
CI01000004_12646972_12652534.mRNA mRNA downstream 144957 12646838 ~ 12652570 (+) False CI01000004_12646972_12652534
TU36123 other upstream 306331 12192130 ~ 12195147 (+) False G31865
TU35811 other upstream 833819 11664773 ~ 11665473 (+) False G31611
TU35813 other upstream 833900 11664773 ~ 11665473 (+) True G31611
TU35938 other upstream 859078 11637251 ~ 11642400 (+) True G31710
TU34813 other upstream 2003690 10497376 ~ 10497788 (+) True G30797
TU36655 other downstream 140873 12642754 ~ 12655711 (+) True G32314
TU37521 other downstream 1521666 14023547 ~ 14031127 (+) True G33092
TU38554 other downstream 2589363 15091244 ~ 15091969 (+) True CI01000004_15091390_15096502
TU38784 other downstream 3437476 15939357 ~ 15939950 (+) True G34220
TU38340 other downstream 3561534 16063415 ~ 16066464 (+) True G33815

Expression Profile


TU36636 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU36636 Expression in each Bioproject

Bar chart with 43 bars.
TU36636 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.