RNA id: TU36699



Basic Information


Item Value
RNA id TU36699
length 234
lncRNA type inter_gene
GC content 0.30
exon number 1
gene id G32350
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12663579 ~ 12663812 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


ATCCGCTCTGTGCTCTCGTGTCTCTGGACCAGAGCAGACTGTGCTCGCGCTGCGGCAGTTCACATTATACTAACGTGAAAACGGACTTCATTCGCGTCAGTGGAAAGCATATTTACACTGTCTGAATCGTTCCCTATTCTCTATATAGTGCACTATGTGCCATTCATGTAGAAACTAGTGAACGTGTGAACAAATGACCGCAGCTTCAGTGTCTGTTGATAGTGTAGGAGGGGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU36636 lncRNA upstream 161698 12501478 ~ 12501881 (+) True G32296
TU36251 lncRNA upstream 176136 12486933 ~ 12487443 (+) True G31969
TU36249 lncRNA upstream 178673 12484698 ~ 12484906 (+) True G31967
TU36241 lncRNA upstream 190174 12473123 ~ 12473405 (+) True G31959
TU36233 lncRNA upstream 200205 12462530 ~ 12463374 (+) True G31952
TU36720 lncRNA downstream 36803 12700615 ~ 12700910 (+) True G32371
TU36736 lncRNA downstream 41152 12704964 ~ 12781485 (+) True G32382
TU36768 lncRNA downstream 145805 12809617 ~ 12810075 (+) True G32414
TU36785 lncRNA downstream 189150 12852962 ~ 12853804 (+) True G32431
TU36795 lncRNA downstream 238725 12902537 ~ 12952107 (+) False G32439
CI01000004_12646972_12652534.mRNA mRNA upstream 11009 12646838 ~ 12652570 (+) False CI01000004_12646972_12652534
CI01000004_12625701_12630744.mRNA mRNA upstream 32653 12624321 ~ 12630926 (+) True CI01000004_12625701_12630744
CI01000004_12594138_12621268.mRNA mRNA upstream 41788 12593163 ~ 12621791 (+) True CI01000004_12594138_12621268
CI01000004_12562823_12563491.mRNA mRNA upstream 99766 12561318 ~ 12563813 (+) True CI01000004_12562823_12563491
CI01000004_12553125_12559468.mRNA mRNA upstream 103703 12552774 ~ 12559876 (+) True CI01000004_12553125_12559468
CI01000004_12696326_12707951.mRNA mRNA downstream 30565 12694377 ~ 12707996 (+) True CI01000004_12696326_12707951
CI01000004_12719753_12721562.mRNA mRNA downstream 54604 12718416 ~ 12722033 (+) True CI01000004_12719753_12721562
CI01000004_12764916_12775989.mRNA mRNA downstream 101104 12764916 ~ 12776172 (+) True CI01000004_12764916_12775989
CI01000004_12810922_12817913.mRNA mRNA downstream 146760 12810572 ~ 12818547 (+) True CI01000004_12810922_12817913
CI01000004_12984968_12997831.mRNA mRNA downstream 321156 12984968 ~ 12998063 (+) True CI01000004_12984968_12997831
TU36655 other upstream 7868 12642754 ~ 12655711 (+) True G32314
TU36123 other upstream 468432 12192130 ~ 12195147 (+) False G31865
TU35811 other upstream 995920 11664773 ~ 11665473 (+) False G31611
TU35813 other upstream 996001 11664773 ~ 11665473 (+) True G31611
TU35938 other upstream 1021179 11637251 ~ 11642400 (+) True G31710
TU37521 other downstream 1359735 14023547 ~ 14031127 (+) True G33092
TU38554 other downstream 2427432 15091244 ~ 15091969 (+) True CI01000004_15091390_15096502
TU38784 other downstream 3275545 15939357 ~ 15939950 (+) True G34220
TU38340 other downstream 3399603 16063415 ~ 16066464 (+) True G33815
TU39001 other downstream 4313516 16977328 ~ 17025469 (+) False G34400

Expression Profile


TU36699 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU36699 Expression in each Bioproject

Bar chart with 28 bars.
TU36699 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.