RNA id: TU36857



Basic Information


Item Value
RNA id TU36857
length 209
lncRNA type inter_gene
GC content 0.39
exon number 1
gene id G32491
representative True

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12977970 ~ 12978178 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CCGGGGGCAGGGTTTATGTAAATTTTAGGGTTAGTGATGTCACCAACCCGGGAAGAAGCTCGTTGTAGTCTCTATCAGCCGTTTGTTGTAGTCCTTAAACAAAGAATTCTTTAAAAGAAAATATCTCCCTTTGCATTGAACTTTGAGTGTCGAAACTTTGCAGATGTTGTTTATGCTCAAACAGCAACATTACACACTAACTAAAGTTA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU36795 lncRNA upstream 25863 12902537 ~ 12952107 (+) False G32439
TU36796 lncRNA upstream 25863 12908340 ~ 12952107 (+) True G32439
TU36785 lncRNA upstream 124166 12852962 ~ 12853804 (+) True G32431
TU36768 lncRNA upstream 167895 12809617 ~ 12810075 (+) True G32414
TU36736 lncRNA upstream 196485 12704964 ~ 12781485 (+) True G32382
TU36860 lncRNA downstream 4251 12982429 ~ 12982669 (+) True G32494
TU36872 lncRNA downstream 23269 13001447 ~ 13001761 (+) True G32506
TU36879 lncRNA downstream 34349 13012527 ~ 13012760 (+) True G32513
TU36868 lncRNA downstream 43156 13021334 ~ 13021822 (+) True G32502
TU36912 lncRNA downstream 54434 13032612 ~ 13032819 (+) True G32538
CI01000004_12810922_12817913.mRNA mRNA upstream 159423 12810572 ~ 12818547 (+) True CI01000004_12810922_12817913
CI01000004_12764916_12775989.mRNA mRNA upstream 201798 12764916 ~ 12776172 (+) True CI01000004_12764916_12775989
CI01000004_12719753_12721562.mRNA mRNA upstream 255937 12718416 ~ 12722033 (+) True CI01000004_12719753_12721562
CI01000004_12696326_12707951.mRNA mRNA upstream 269974 12694377 ~ 12707996 (+) True CI01000004_12696326_12707951
CI01000004_12646972_12652534.mRNA mRNA upstream 325400 12646838 ~ 12652570 (+) False CI01000004_12646972_12652534
CI01000004_12984968_12997831.mRNA mRNA downstream 6790 12984968 ~ 12998063 (+) True CI01000004_12984968_12997831
CI01000004_13043279_13051835.mRNA mRNA downstream 65059 13043237 ~ 13051964 (+) False CI01000004_13043279_13051835
CI01000004_13062721_13076100.mRNA mRNA downstream 84543 13062721 ~ 13076228 (+) True CI01000004_13062721_13076100
CI01000004_13197104_13205895.mRNA mRNA downstream 218926 13197104 ~ 13206585 (+) True CI01000004_13197104_13205895
CI01000004_13211489_13233786.mRNA mRNA downstream 233311 13211489 ~ 13234194 (+) True CI01000004_13211489_13233786
TU36655 other upstream 322259 12642754 ~ 12655711 (+) True G32314
TU36123 other upstream 782823 12192130 ~ 12195147 (+) False G31865
TU35811 other upstream 1310311 11664773 ~ 11665473 (+) False G31611
TU35813 other upstream 1310392 11664773 ~ 11665473 (+) True G31611
TU35938 other upstream 1335570 11637251 ~ 11642400 (+) True G31710
TU37521 other downstream 1045369 14023547 ~ 14031127 (+) True G33092
TU38554 other downstream 2113066 15091244 ~ 15091969 (+) True CI01000004_15091390_15096502
TU38784 other downstream 2961179 15939357 ~ 15939950 (+) True G34220
TU38340 other downstream 3085237 16063415 ~ 16066464 (+) True G33815
TU39001 other downstream 3999150 16977328 ~ 17025469 (+) False G34400

Expression Profile


TU36857 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU36857 Expression in each Bioproject

Bar chart with 20 bars.
TU36857 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.