RNA id: TCONS_00001192


Basic Information

Item Value
RNA id TCONS_00001192
length 516
RNA type mRNA
GC content 0.52
exon number 5
gene id XLOC_000717
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 54638126 ~ 54648766 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATTGTCCAGCGGCGCCGCCATCTTTAAACAGTCAACAGTATTAGAAGTCAAGCGGAGACTTTTAAGGGAAATCTTTAATAATGGAGAAAGGACCCGCTCTCCCTCCATATTCTGGTCCTGAGGTCAACCAAACTCAGTTCACACCTTACCCAGTACAATACCAGCCTCAGCCAGTTTATCCACCTCATCCCAAAGATGGTTTTGCTCCAGCGGTCCAGTCTTCACCAGCACCTGTTGTAGTCACGCAGGTGGTTATGATGCCACCTAGTCTGAGCGATGTCCCGGGACAGACGAAATGTCCTCACTGCCAGCAGCAGATCATCACAGAGACGCGATACGTCAACGGCCTGCTCACCTGGCTCATCTGCGGAGGTCTCGGCATTCTGCTGATCTGGCCGTGTTGTCTGATTCCCTTCTGTGTGAGCGCCTGCAAGGACGTAGAGCATCGCTGTCCAAACTGCAAGCATGTCGTCTTCCTGTACAAACGCATGTAGCTCGCAGGTCTGGGATGATCTT

Function

GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-090313-78 Predicted to enable metal ion binding activity. Predicted to be located in endosome membrane and lysosomal membrane. Predicted to be integral component of membrane. Orthologous to human LITAFD (LITAF domain containing).

Ensembl:

ensembl_id ENSDART00000143997

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003179 lncRNA upstream 24647 54611838 ~ 54613479 (+) True XLOC_000715
TCONS_00003177 lncRNA upstream 168837 54277243 ~ 54469289 (+) True XLOC_000712
TCONS_00003178 lncRNA upstream 233979 54401933 ~ 54404147 (+) True XLOC_000713
TCONS_00003176 lncRNA upstream 649350 53982614 ~ 53988776 (+) True XLOC_000703
TCONS_00001173 lncRNA upstream 689618 53946000 ~ 53948508 (+) True XLOC_000701
TCONS_00003180 lncRNA downstream 50523 54698173 ~ 54700755 (+) False XLOC_000721
TCONS_00003181 lncRNA downstream 50533 54698183 ~ 54700755 (+) False XLOC_000721
TCONS_00003182 lncRNA downstream 50538 54698188 ~ 54700755 (+) True XLOC_000721
TCONS_00001210 lncRNA downstream 258100 54905750 ~ 54906707 (+) True XLOC_000726
TCONS_00003183 lncRNA downstream 311842 54959492 ~ 54985297 (+) False XLOC_000729
TCONS_00001191 mRNA upstream 748 54626491 ~ 54637378 (+) True XLOC_000716
TCONS_00001190 mRNA upstream 30094 54606354 ~ 54608032 (+) True XLOC_000714
TCONS_00001188 mRNA upstream 363265 54198893 ~ 54274861 (+) False XLOC_000711
TCONS_00001189 mRNA upstream 364304 54199406 ~ 54273822 (+) True XLOC_000711
TCONS_00001187 mRNA upstream 439036 54194801 ~ 54199090 (+) False XLOC_000711
TCONS_00001194 mRNA downstream 2398 54650048 ~ 54659923 (+) False XLOC_000718
TCONS_00001195 mRNA downstream 7510 54655160 ~ 54659806 (+) True XLOC_000718
TCONS_00001196 mRNA downstream 26196 54673846 ~ 54680103 (+) False XLOC_000719
TCONS_00001197 mRNA downstream 29523 54677173 ~ 54680103 (+) True XLOC_000719
TCONS_00001198 mRNA downstream 36005 54683655 ~ 54694012 (+) False XLOC_000720
TCONS_00001186 other upstream 451970 54186039 ~ 54186156 (+) True XLOC_000710
TCONS_00001180 other upstream 576916 54053104 ~ 54061210 (+) True XLOC_000705
TCONS_00001166 other upstream 1250245 53387765 ~ 53387881 (+) True XLOC_000690
TCONS_00001160 other upstream 1270092 53364510 ~ 53368034 (+) True XLOC_000689
TCONS_00001154 other upstream 1576929 52999832 ~ 53061197 (+) False XLOC_000682
TCONS_00001221 other downstream 480815 55128465 ~ 55128579 (+) True XLOC_000733
TCONS_00001233 other downstream 645975 55293625 ~ 55297251 (+) False XLOC_000739
TCONS_00001304 other downstream 2700248 57347898 ~ 57355033 (+) False XLOC_000813
TCONS_00001335 other downstream 3512501 58160151 ~ 58173589 (+) True XLOC_000837
TCONS_00001394 other downstream 4483642 59131292 ~ 59131406 (+) True XLOC_000888

Expression Profile

//