RNA id: TCONS_00001195


Basic Information

Item Value
RNA id TCONS_00001195
length 378
RNA type mRNA
GC content 0.52
exon number 3
gene id XLOC_000718
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 54650048 ~ 54659923 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGAAAAGGGAATGTCACCTCCGCCATATCCTGGCCCTCCACTGGTCCAGAACAACATTACCTACCAGCAGCCGCCGGTTACTTATCAACCTCAAGCAGGTCAGCTGAACAAAGCCCTAAAATTGACCACAGTGGTGCTCATGCCCTCACGACTGGGTGAGTGTCCAGGACAGATGAGATGTCCTCACTGCCAGCAGCAGGTGGTGACCGAGACCACATATGTCAACGGACTGTTGGTGTGGGGCATCTGCATTGGTCTCGGCATTTTCGGGATCTGGCCGTGTTGTTTGATTCCCTTCTGTGTGGATTCCTGCAAAGACGTCCAGCATCGCTGTCCAGGCTGCAAATCTCTTGTGTATGTGTACAAACGTAGTTAA

Function

GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-090313-77 Predicted to enable metal ion binding activity. Predicted to be located in endosome membrane and lysosomal membrane. Predicted to be integral component of membrane. Orthologous to human LITAFD (LITAF domain containing).

Ensembl:

ensembl_id ENSDART00000190319

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003179 lncRNA upstream 41681 54611838 ~ 54613479 (+) True XLOC_000715
TCONS_00003177 lncRNA upstream 185871 54277243 ~ 54469289 (+) True XLOC_000712
TCONS_00003178 lncRNA upstream 251013 54401933 ~ 54404147 (+) True XLOC_000713
TCONS_00003176 lncRNA upstream 666384 53982614 ~ 53988776 (+) True XLOC_000703
TCONS_00001173 lncRNA upstream 706652 53946000 ~ 53948508 (+) True XLOC_000701
TCONS_00003180 lncRNA downstream 38367 54698173 ~ 54700755 (+) False XLOC_000721
TCONS_00003181 lncRNA downstream 38377 54698183 ~ 54700755 (+) False XLOC_000721
TCONS_00003182 lncRNA downstream 38382 54698188 ~ 54700755 (+) True XLOC_000721
TCONS_00001210 lncRNA downstream 245944 54905750 ~ 54906707 (+) True XLOC_000726
TCONS_00003183 lncRNA downstream 299686 54959492 ~ 54985297 (+) False XLOC_000729
TCONS_00001193 mRNA upstream 6394 54638793 ~ 54648766 (+) True XLOC_000717
TCONS_00001192 mRNA upstream 7510 54638126 ~ 54647650 (+) False XLOC_000717
TCONS_00001191 mRNA upstream 17782 54626491 ~ 54637378 (+) True XLOC_000716
TCONS_00001190 mRNA upstream 47128 54606354 ~ 54608032 (+) True XLOC_000714
TCONS_00001189 mRNA upstream 381338 54199406 ~ 54273822 (+) True XLOC_000711
TCONS_00001196 mRNA downstream 14040 54673846 ~ 54680103 (+) False XLOC_000719
TCONS_00001197 mRNA downstream 17367 54677173 ~ 54680103 (+) True XLOC_000719
TCONS_00001198 mRNA downstream 23849 54683655 ~ 54694012 (+) False XLOC_000720
TCONS_00001199 mRNA downstream 27810 54687616 ~ 54689390 (+) True XLOC_000720
TCONS_00001200 mRNA downstream 77547 54737353 ~ 54755556 (+) False XLOC_000722
TCONS_00001186 other upstream 469004 54186039 ~ 54186156 (+) True XLOC_000710
TCONS_00001180 other upstream 593950 54053104 ~ 54061210 (+) True XLOC_000705
TCONS_00001166 other upstream 1267279 53387765 ~ 53387881 (+) True XLOC_000690
TCONS_00001160 other upstream 1287126 53364510 ~ 53368034 (+) True XLOC_000689
TCONS_00001154 other upstream 1593963 52999832 ~ 53061197 (+) False XLOC_000682
TCONS_00001221 other downstream 468659 55128465 ~ 55128579 (+) True XLOC_000733
TCONS_00001233 other downstream 633819 55293625 ~ 55297251 (+) False XLOC_000739
TCONS_00001304 other downstream 2688092 57347898 ~ 57355033 (+) False XLOC_000813
TCONS_00001335 other downstream 3500345 58160151 ~ 58173589 (+) True XLOC_000837
TCONS_00001394 other downstream 4471486 59131292 ~ 59131406 (+) True XLOC_000888

Expression Profile

//