Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU135971

Basic Information

Item	Value
RNA id	TU135971
length	230
lncRNA type	inter_gene
GC content	0.23
exon number	1
gene id	G119747
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000021
NCBI id	null
chromosome length	7014339
location	6975787 ~ 6976016 (+)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

ATATTTTCAAATGATGTACTTTTATACTATACTTTTATAAATATACTTTTAAGTATATCTTGATCAAAGACTGAATCCAAGTATAGGCCAAATATACTTAGACTTTTCTGTCAGTATAAGTCAAGCATACTTAAGTGCAATTTTAAGTATATTTCTCAGAAGTACATAAAGTATATTTTTGAGAAGTATATAAAAAGTAGACTGAAAGTATACTTATTTTTAGTTTAAAA

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU135955	lncRNA	upstream	22851	6952727 ~ 6952936 (+)	True	G119731
TU135954	lncRNA	upstream	24306	6949473 ~ 6951481 (+)	True	G119730
TU135948	lncRNA	upstream	95169	6879752 ~ 6880618 (+)	True	G119724
TU135916	lncRNA	upstream	184825	6789876 ~ 6790962 (+)	True	CI01000021_06786996_06789224
TU135910	lncRNA	upstream	204708	6743219 ~ 6771079 (+)	True	CI01000021_06746518_06768316
TU135974	lncRNA	downstream	6495	6982511 ~ 6982714 (+)	True	G119750
CI01000021_06941580_06949099.mRNA	mRNA	upstream	26688	6941580 ~ 6949099 (+)	True	CI01000021_06941580_06949099
CI01000021_06938981_06939825.mRNA	mRNA	upstream	35962	6938821 ~ 6939825 (+)	True	CI01000021_06938981_06939825
CI01000021_06906415_06933563.mRNA	mRNA	upstream	41646	6906415 ~ 6934141 (+)	True	CI01000021_06906415_06933563
CI01000021_06798250_06824148.mRNA	mRNA	upstream	151301	6798250 ~ 6824486 (+)	True	CI01000021_06798250_06824148
CI01000021_06786996_06789224.mRNA	mRNA	upstream	184987	6786861 ~ 6790800 (+)	False	CI01000021_06786996_06789224
TU135922	other	upstream	115181	6800144 ~ 6860606 (+)	True	G119701
TU134547	other	upstream	2086279	4842733 ~ 4886292 (+)	True	G118432
TU133514	other	upstream	2940111	4033000 ~ 4035676 (+)	True	G117493
TU133500	other	upstream	3018035	3956146 ~ 3957752 (+)	True	G117484
TU133182	other	upstream	3647554	3324272 ~ 3328233 (+)	True	G117202

Expression Profile