Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU156727

Basic Information

Item	Value
RNA id	TU156727
length	195
lncRNA type	inter_gene
GC content	0.53
exon number	1
gene id	G137979
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000026
NCBI id	null
chromosome length	17172400
location	17084025 ~ 17084219 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

GCACTTAAGGTTCCTAAGAGCACAGTGGCCTCCATAATCCTTAAATGGAAGATGTTTGGGACGACCAGAACCCTTCCTAGAGCTGGCCGTCCGGCCAAACTGAGCTATCGGGGGAGAAGAGCCTTGGTGAGAGAGGTAAAGAAGAACCCAAAGATCACTGTGGCTGAGCTCCAGAGATGCAGTCGGGAGATGGGA

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU156714	lncRNA	downstream	16506	17067015 ~ 17067519 (-)	True	G137966
TU156710	lncRNA	downstream	23953	17059869 ~ 17060072 (-)	True	G137962
TU156707	lncRNA	downstream	34808	17049014 ~ 17049217 (-)	True	G137959
TU156706	lncRNA	downstream	35547	17048268 ~ 17048478 (-)	True	G137958
TU156671	lncRNA	downstream	125730	16958051 ~ 16958295 (-)	True	G137928
TU156742	lncRNA	upstream	20981	17105200 ~ 17105555 (-)	True	G137994
TU156765	lncRNA	upstream	62263	17146482 ~ 17147927 (-)	True	G138017
CI01000026_17021405_17034147.mRNA	mRNA	downstream	49878	17020517 ~ 17034147 (-)	True	CI01000026_17021405_17034147
CI01000026_16988458_16994714.mRNA	mRNA	downstream	88921	16987816 ~ 16995104 (-)	True	CI01000026_16988458_16994714
CI01000026_16959659_16962519.mRNA	mRNA	downstream	120804	16959273 ~ 16963221 (-)	True	CI01000026_16959659_16962519
CI01000026_16817010_16832208.mRNA	mRNA	downstream	251817	16816295 ~ 16832208 (-)	True	CI01000026_16817010_16832208
CI01000026_16756776_16760261.mRNA	mRNA	downstream	323764	16756776 ~ 16760261 (-)	False	CI01000026_16756776_16760261
TU156715	other	downstream	14592	17068348 ~ 17069433 (-)	True	G137967
TU156657	other	downstream	99673	16983251 ~ 16984352 (-)	True	G137914
TU156388	other	downstream	275653	16806364 ~ 16808372 (-)	True	G137667
TU156370	other	downstream	325698	16756729 ~ 16758327 (-)	False	CI01000026_16756776_16760261
TU154700	other	downstream	2528589	14554917 ~ 14555436 (-)	True	G136110

Expression Profile