RNA id: TCONS_00001252



Basic Information


Item Value
RNA id TCONS_00001252
length 562
RNA type mRNA
GC content 0.50
exon number 8
gene id XLOC_000764
representative False

Chromosome Information


Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 55752593 ~ 55777154 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GCTATTCAAACTGCAAAGATGAAGCATTACGAGGTGTTTCTGACGGAGTACGCCGGCCCTCTGCTCATATATCTGATGTTTTACTTCCGAGTGCCCTTCATTTATGCACCCAAATACGACTTCACCACCAGCAAACACTGGGTCGTACATTTGGCCTGTATGTGTCACTCCTTTCACTACGTGAAGAGGCTTCTGGAAACACTTTTCGTCCATCGCTTCTCACATGGGACTATGCCTCTCCGCAACATCTTTAAGAACTGTACATACTACTGGGGCTTTGCAGCTTGGATGGCCTATTATATCAACCACCCGCTCTACACACCGCCCATCTATGGAGAGCAGCAGATCAGACTGGCCCTCACTGTGTTTCTGTTCTGTCAGATTGGAAACTTCTCCATCCACATCGCCTTGAGGAATCTCCGACCACCCGGCTCTAAGACTAGAAAGATCCCGTACCCGACTAAAAACCCCTTCACCTGGATCTTCCTGCTGGTTTCCTGCCCCAATTACACATATGAGCTGGGCTCATGGCTGGGCTTCACCCTGATGACGCAGTGTTTGC

Function


GO:

id name namespace
GO:0006629 lipid metabolic process biological_process
GO:0042761 very long-chain fatty acid biosynthetic process biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0016491 oxidoreductase activity molecular_function
GO:0016627 oxidoreductase activity, acting on the CH-CH group of donors molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-5154 Predicted to enable oxidoreductase activity. Predicted to be involved in very long-chain fatty acid biosynthetic process. Predicted to act upstream of or within lipid metabolic process. Predicted to be located in endoplasmic reticulum membrane. Predicted to be integral component of membrane. Is expressed in several structures, including digestive system; eye; forebrain; musculature system; and solid lens vesicle. Human ortholog(s) of this gene implicated in autosomal recessive non-syndromic intellectual disability. Orthologous to human TECR (trans-2,3-enoyl-CoA reductase).

Ensembl:

ensembl_id ENSDART00000134770

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00003235 lncRNA upstream 23559 55714918 ~ 55729126 (+) True XLOC_000760
TCONS_00003236 lncRNA upstream 31270 55717578 ~ 55721415 (+) True XLOC_000761
TCONS_00003234 lncRNA upstream 73238 55678912 ~ 55679447 (+) True XLOC_000758
TCONS_00003233 lncRNA upstream 85325 55666862 ~ 55667360 (+) True XLOC_000757
TCONS_00003231 lncRNA upstream 275550 55456363 ~ 55477135 (+) False XLOC_000745
TCONS_00003237 lncRNA downstream 640028 56416638 ~ 56556305 (+) True XLOC_000768
TCONS_00003238 lncRNA downstream 784616 56561226 ~ 56604170 (+) False XLOC_000772
TCONS_00003239 lncRNA downstream 784643 56561253 ~ 56604352 (+) True XLOC_000772
TCONS_00003240 lncRNA downstream 786217 56562827 ~ 56564352 (+) True XLOC_000773
TCONS_00003241 lncRNA downstream 792904 56569514 ~ 56603810 (+) True XLOC_000774
TCONS_00001250 mRNA upstream 5682 55730205 ~ 55747003 (+) True XLOC_000763
TCONS_00001249 mRNA upstream 24227 55723870 ~ 55728458 (+) True XLOC_000762
TCONS_00001248 mRNA upstream 45349 55703120 ~ 55707336 (+) True XLOC_000759
TCONS_00001247 mRNA upstream 84295 55662491 ~ 55668390 (+) False XLOC_000757
TCONS_00001246 mRNA upstream 106272 55643198 ~ 55646413 (+) True XLOC_000756
TCONS_00001255 mRNA downstream 403806 56180416 ~ 56184928 (+) True XLOC_000765
TCONS_00001256 mRNA downstream 453064 56229674 ~ 56266731 (+) True XLOC_000766
TCONS_00001257 mRNA downstream 498003 56274613 ~ 56320569 (+) True XLOC_000767
TCONS_00001258 mRNA downstream 670497 56447107 ~ 56458037 (+) True XLOC_000769
TCONS_00001259 mRNA downstream 686884 56463494 ~ 56468601 (+) True XLOC_000770
TCONS_00001233 other upstream 455434 55293625 ~ 55297251 (+) False XLOC_000739
TCONS_00001221 other upstream 624106 55128465 ~ 55128579 (+) True XLOC_000733
TCONS_00001186 other upstream 1566529 54186039 ~ 54186156 (+) True XLOC_000710
TCONS_00001180 other upstream 1691475 54053104 ~ 54061210 (+) True XLOC_000705
TCONS_00001166 other upstream 2364804 53387765 ~ 53387881 (+) True XLOC_000690
TCONS_00001304 other downstream 1571288 57347898 ~ 57355033 (+) False XLOC_000813
TCONS_00001335 other downstream 2383541 58160151 ~ 58173589 (+) True XLOC_000837
TCONS_00001394 other downstream 3354682 59131292 ~ 59131406 (+) True XLOC_000888

Expression Profile


//