RNA id: TCONS_00001254


Basic Information

Item Value
RNA id TCONS_00001254
length 768
RNA type mRNA
GC content 0.49
exon number 9
gene id XLOC_000764
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 55752593 ~ 55777154 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CGAGGATTGCTCTTGTGTGTCCGCGGATTAACCACTGCTTCCTGGTGATGTCACAGGGCAACACTTGTGATGTCATGATGATGTCATCTGAAGAGGGAGAGATTCAGTCAAGGCAGATTTGTGTAGAATTAATGGATTTTTCCCATGTAGAATGGCAGTACTGGAGGAGCTTTTAAAGGTGCAGGTCGAGCCCAATGCAACAATCGGAGAAATCAAATCCATGTTCCACAAGAGCCACCCTCAGTGGTATCCGGCTCGACAGTCCATCCGCTTGGATCCCAAGGGTAAATCTCTGAAGGATGAGGATGTGCTGCAGCATCTGCCTGTAGGAACCACTGCAACCTTCTACTTCAGAGACCTGGGGGCGCAGATCAGCTGGGTCACGGTGTTTCTGACGGAGTACGCCGGCCCTCTGCTCATATATCTGATGTTTTACTTCCGAGTGCCCTTCATTTATGCACCCAAATACGACTTCACCACCAGCAAACACTGGGTCGTACATTTGGCCTGTATGTGTCACTCCTTTCACTACGTGAAGAGGCTTCTGGAAACACTTTTCGTCCATCGCTTCTCACATGGGACTATGCCTCTCCGCAACATCTTTAAGAACTGTACATACTACTGGGGCTTTGCAGCTTGGATGGCCTATTATATCAACCACCCGCTCTACACACCGCCCATCTATGGAGAGCAGCAGATCAGACTGGCCCTCACTGTGTTTCTGTTCTGTCAGATTGGAAACTTCTCCATCCACATCGCCTTGAGGAA

Function

GO:

id name namespace
GO:0006629 lipid metabolic process biological_process
GO:0042761 very long-chain fatty acid biosynthetic process biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0016491 oxidoreductase activity molecular_function
GO:0016627 oxidoreductase activity, acting on the CH-CH group of donors molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-5154 Predicted to enable oxidoreductase activity. Predicted to be involved in very long-chain fatty acid biosynthetic process. Predicted to act upstream of or within lipid metabolic process. Predicted to be located in endoplasmic reticulum membrane. Predicted to be integral component of membrane. Is expressed in several structures, including digestive system; eye; forebrain; musculature system; and solid lens vesicle. Human ortholog(s) of this gene implicated in autosomal recessive non-syndromic intellectual disability. Orthologous to human TECR (trans-2,3-enoyl-CoA reductase).

Ensembl:

ensembl_id ENSDART00000139312

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003235 lncRNA upstream 29131 55714918 ~ 55729126 (+) True XLOC_000760
TCONS_00003236 lncRNA upstream 36842 55717578 ~ 55721415 (+) True XLOC_000761
TCONS_00003234 lncRNA upstream 78810 55678912 ~ 55679447 (+) True XLOC_000758
TCONS_00003233 lncRNA upstream 90897 55666862 ~ 55667360 (+) True XLOC_000757
TCONS_00003231 lncRNA upstream 281122 55456363 ~ 55477135 (+) False XLOC_000745
TCONS_00003237 lncRNA downstream 642335 56416638 ~ 56556305 (+) True XLOC_000768
TCONS_00003238 lncRNA downstream 786923 56561226 ~ 56604170 (+) False XLOC_000772
TCONS_00003239 lncRNA downstream 786950 56561253 ~ 56604352 (+) True XLOC_000772
TCONS_00003240 lncRNA downstream 788524 56562827 ~ 56564352 (+) True XLOC_000773
TCONS_00003241 lncRNA downstream 795211 56569514 ~ 56603810 (+) True XLOC_000774
TCONS_00001250 mRNA upstream 11254 55730205 ~ 55747003 (+) True XLOC_000763
TCONS_00001249 mRNA upstream 29799 55723870 ~ 55728458 (+) True XLOC_000762
TCONS_00001248 mRNA upstream 50921 55703120 ~ 55707336 (+) True XLOC_000759
TCONS_00001247 mRNA upstream 89867 55662491 ~ 55668390 (+) False XLOC_000757
TCONS_00001246 mRNA upstream 111844 55643198 ~ 55646413 (+) True XLOC_000756
TCONS_00001255 mRNA downstream 406113 56180416 ~ 56184928 (+) True XLOC_000765
TCONS_00001256 mRNA downstream 455371 56229674 ~ 56266731 (+) True XLOC_000766
TCONS_00001257 mRNA downstream 500310 56274613 ~ 56320569 (+) True XLOC_000767
TCONS_00001258 mRNA downstream 672804 56447107 ~ 56458037 (+) True XLOC_000769
TCONS_00001259 mRNA downstream 689191 56463494 ~ 56468601 (+) True XLOC_000770
TCONS_00001233 other upstream 461006 55293625 ~ 55297251 (+) False XLOC_000739
TCONS_00001221 other upstream 629678 55128465 ~ 55128579 (+) True XLOC_000733
TCONS_00001186 other upstream 1572101 54186039 ~ 54186156 (+) True XLOC_000710
TCONS_00001180 other upstream 1697047 54053104 ~ 54061210 (+) True XLOC_000705
TCONS_00001166 other upstream 2370376 53387765 ~ 53387881 (+) True XLOC_000690
TCONS_00001304 other downstream 1573595 57347898 ~ 57355033 (+) False XLOC_000813
TCONS_00001335 other downstream 2385848 58160151 ~ 58173589 (+) True XLOC_000837
TCONS_00001394 other downstream 3356989 59131292 ~ 59131406 (+) True XLOC_000888

Expression Profile

//