RNA id: TCONS_00015485


Basic Information

Item Value
RNA id TCONS_00015485
length 541
lncRNA type retained_intron
GC content 0.44
exon number 3
gene id XLOC_007936
representative True

Chromosome Information

Item Value
chromosome id NC_007125.7
NCBI id CM002898.2
chromosome length 52660232
location 30713736 ~ 30724165 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAACGTTTCAGATGTGCGAGAGACTTTTACACCACCCAGCCAAACTGGCCAATCAGCTTCTGTTTCAGATACCGCCAGACCGACAAGCCATGCTCATTGAACGGTATTATGCTTTTGATGATTTGTTTGTACGTGAGGTCTTGGGAAAGAAACTGTCAAAAGGAACTAAAAAAGATCTTGATGACGTCAGTGCAAAGACAGGCATTTCGCTGAAGAGCTGCCGAAGACAGGTGGACTGTCTGAAACTATACATTTCTCATATGCTACTAAGATTTGTTTTGAAGTGATTACAGTACATCTTTCTCCTCAAATACAGTTTGACAACTTCAAGCGAGTGTTTAAAGTGGTGGAAGAACTTAAGGGCCCCCTGGTGGAAAATATACGACAGCACTTTCTGCTACCTGATCAGTTAGCCAGAGACTATGCTGCAATCGTGTTCTTTGCCAATAATCGTTTTGAGACGGGGAAGAAGAAGTTGCTGTATTTAACCTTCCAGGACTTTGCCTTTTGTGCTGGGCAGCTCATCAACCACTGGACTCTC

Function

GO:

id name namespace
GO:0008150 biological_process biological_process
GO:0005575 cellular_component cellular_component
GO:0005634 nucleus cellular_component
GO:0017134 fibroblast growth factor binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1363 Predicted to enable fibroblast growth factor binding activity. Predicted to be active in nucleus. Orthologous to human FIBP (FGF1 intracellular binding protein).

Ensembl:

ensembl_id ENSDART00000133126

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00015476 lncRNA downstream 182297 30511481 ~ 30536884 (-) True XLOC_007930
TCONS_00015475 lncRNA downstream 195706 30511481 ~ 30523475 (-) False XLOC_007930
TCONS_00015468 lncRNA downstream 266988 30440748 ~ 30452193 (-) True XLOC_007928
TCONS_00016411 lncRNA downstream 421010 30297374 ~ 30298171 (-) True XLOC_007925
TCONS_00016410 lncRNA downstream 919188 29785289 ~ 29799993 (-) True XLOC_007921
TCONS_00015487 lncRNA upstream 25086 30745444 ~ 30747686 (-) True XLOC_007937
TCONS_00015491 lncRNA upstream 135313 30855671 ~ 30865767 (-) False XLOC_007939
TCONS_00015493 lncRNA upstream 142583 30862941 ~ 30876549 (-) True XLOC_007939
TCONS_00015496 lncRNA upstream 164070 30884428 ~ 30885316 (-) True XLOC_007940
TCONS_00015512 lncRNA upstream 247086 30967444 ~ 30968166 (-) True XLOC_007945
TCONS_00015483 mRNA downstream 15106 30669662 ~ 30704075 (-) True XLOC_007935
TCONS_00015482 mRNA downstream 76362 30636955 ~ 30642819 (-) True XLOC_007934
TCONS_00015480 mRNA downstream 131320 30580681 ~ 30587861 (-) False XLOC_007933
TCONS_00015481 mRNA downstream 131367 30581274 ~ 30587814 (-) True XLOC_007933
TCONS_00015478 mRNA downstream 161544 30550397 ~ 30557637 (-) False XLOC_007932
TCONS_00015486 mRNA upstream 19118 30739476 ~ 30747686 (-) False XLOC_007937
TCONS_00015488 mRNA upstream 82107 30802465 ~ 30808174 (-) False XLOC_007938
TCONS_00015489 mRNA upstream 83562 30803920 ~ 30805091 (-) True XLOC_007938
TCONS_00015490 mRNA upstream 134195 30854553 ~ 30876708 (-) False XLOC_007939
TCONS_00015492 mRNA upstream 135616 30855974 ~ 30876299 (-) False XLOC_007939
TCONS_00015467 other downstream 266971 30437922 ~ 30452210 (-) False XLOC_007928
TCONS_00015446 other downstream 1366058 29353007 ~ 29353123 (-) True XLOC_007918
TCONS_00015433 other downstream 2590903 28128158 ~ 28128278 (-) True XLOC_007910
TCONS_00015429 other downstream 3162559 27556486 ~ 27556622 (-) True XLOC_007906
TCONS_00015426 other downstream 3543340 27175726 ~ 27175841 (-) True XLOC_007904
TCONS_00015524 other upstream 606243 31326601 ~ 31326717 (-) True XLOC_007951
TCONS_00015525 other upstream 746313 31466671 ~ 31466782 (-) False XLOC_007952
TCONS_00015526 other upstream 746668 31467026 ~ 31467130 (-) False XLOC_007952
TCONS_00015527 other upstream 746809 31467167 ~ 31467260 (-) False XLOC_007952
TCONS_00015528 other upstream 747018 31467376 ~ 31467460 (-) True XLOC_007952

Expression Profile

//