RNA id: TCONS_00015928



Basic Information


Item Value
RNA id TCONS_00015928
length 823
RNA type processed_transcript
GC content 0.54
exon number 6
gene id XLOC_008187
representative False

Chromosome Information


Item Value
chromosome id NC_007125.7
NCBI id CM002898.2
chromosome length 52660232
location 52377557 ~ 52408817 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GCAGGCTGAAGCCCAGCACACATCTGGAGAGGTGGAGGAACCGCCTCGTTACCTGCTGAAGTTTGAGCAGATCTACCTGTCCAAACCCACGCACTGGGAAAGAGACGGCGCTCCGTCCCCTATGATGCCGAACGAAGCCAGACTTCGAAATCTCACGTATTCTGCTCCTCTGTATGTGGACATCACAAAGACCATCATAAAGGACGGGGAGGAGCAGCAGCAGACGCAGCATCAGAAAACATTCATCGGCAAGATTCCCATCATGCTCCGCTCCACGTACTGTCTGCTGAGCGGGCTGACGGACAGAGATCTCTGTGAGCTGAACGAGTGTCCACTGGACCCCGGAGGATACTTCATCATCAACGGCTCAGAGAAGGTTCTGATTGCTCAGGAAAAGATGGCCACTAACACAGTGTATGTGTTCGCCAAGAAAGACTCCAAATATGCGTACACCGGAGAGTGCAGGTCCTGTCTGGAGAACTCGTCCAGACCCACCAGCACCATCTGGGTCAGCATGATGGCCCGAGGAGGACAGGTAAAGCCGTCTCTGGATGAGGCGTTTGTGATTCAGGAGCAGAACGTGGCTCTGAACTTCATCGGCTCCAGAGGGGCCAAACCTGGAGTCACTAAAGAGAGGAGAATTAAATACGCTAAAGAGGTTCTGCAGAAGGAGGTGCTGCCGCATGTGGGTGTGTCAGACTTCTGCGAGACCAAGAAGGCTTACTTTCTAGGTTATATGGTCCACCGTCTGCTGCTGGCCGCTCTGGGCCGACGAGAGCTGGACGACAGAGATCATTACGGCAACAAGAGGCTGGATCTCGCT

Function


GO:

id name namespace
GO:0006351 transcription, DNA-templated biological_process
GO:0005665 RNA polymerase II, core complex cellular_component
GO:0003899 DNA-directed 5'-3' RNA polymerase activity molecular_function
GO:0016740 transferase activity molecular_function
GO:0016779 nucleotidyltransferase activity molecular_function
GO:0003677 DNA binding molecular_function
GO:0032549 ribonucleoside binding molecular_function

KEGG:

id description
ko03020 RNA polymerase
ko05016 Huntington disease
ko03021 Transcription machinery
ko03400 DNA repair and recombination proteins

ZFIN:

id description
ZDB-GENE-041008-1 Predicted to enable several functions, including DNA binding activity; metal ion binding activity; and ribonucleoside binding activity. Predicted to contribute to DNA-directed 5'-3' RNA polymerase activity. Predicted to act upstream of or within transcription, DNA-templated. Predicted to be part of RNA polymerase II, core complex. Orthologous to human POLR2B (RNA polymerase II subunit B).

Ensembl:

ensembl_id ENSDART00000167276

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00016094 lncRNA downstream 206541 52189877 ~ 52191692 (-) True XLOC_008186
TCONS_00016093 lncRNA downstream 494595 51903159 ~ 51903638 (-) True XLOC_008184
TCONS_00016532 lncRNA downstream 560846 51826078 ~ 51837387 (-) True XLOC_008182
TCONS_00016092 lncRNA downstream 778775 51611220 ~ 51619458 (-) True XLOC_008179
TCONS_00016531 lncRNA downstream 1411627 50972410 ~ 50986606 (-) False XLOC_008176
TCONS_00016534 lncRNA upstream 170255 52575963 ~ 52576704 (-) True XLOC_008192
TCONS_00015924 mRNA downstream 543186 51829317 ~ 51855047 (-) True XLOC_008183
TCONS_00015921 mRNA downstream 778845 51164056 ~ 51619388 (-) False XLOC_008179
TCONS_00015920 mRNA downstream 1358531 51023954 ~ 51039702 (-) True XLOC_008178
TCONS_00015919 mRNA downstream 1383941 50994138 ~ 51014292 (-) True XLOC_008177
TCONS_00015918 mRNA downstream 1505791 50839282 ~ 50892442 (-) True XLOC_008175
TCONS_00015931 mRNA upstream 12539 52418247 ~ 52433292 (-) True XLOC_008188
TCONS_00015932 mRNA upstream 70812 52476520 ~ 52480661 (-) False XLOC_008189
TCONS_00015934 mRNA upstream 114496 52520204 ~ 52521460 (-) True XLOC_008190
TCONS_00015935 mRNA upstream 117009 52522717 ~ 52552875 (-) False XLOC_008191
TCONS_00015936 mRNA upstream 119879 52525587 ~ 52542928 (-) True XLOC_008191
TCONS_00015925 other downstream 348959 52049158 ~ 52049274 (-) True XLOC_008185
TCONS_00015923 other downstream 645036 51753080 ~ 51753197 (-) True XLOC_008181
TCONS_00015922 other downstream 1124933 51273185 ~ 51273300 (-) True XLOC_008180
TCONS_00015911 other downstream 2643283 49754834 ~ 49754950 (-) True XLOC_008166
TCONS_00015906 other downstream 3348345 49040191 ~ 49049888 (-) True XLOC_008156
TCONS_00015930 other upstream 47 52405755 ~ 52408817 (-) True XLOC_008187
TCONS_00015933 other upstream 70973 52476681 ~ 52478944 (-) True XLOC_008189