RNA id: TU260698



Basic Information


Item Value
RNA id TU260698
length 286
lncRNA type intronic
GC content 0.41
exon number 1
gene id G229736
representative True

Chromosome Information


Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 917989 ~ 918274 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


CACACAGGACAGCACTACACAGAAACATACAAACAAGGAGATTACTTTAACACACTCCAACTAGTTAATGGTAAGTATAAACACAGAGTTACCAAGACTCTTATTCCTCGTCTGGGATCATGTAGAGCCCTTTGAAGCTGCACTGAAACTGCAATTTGGACCTTCAACCCGTTGGTCCCTGTTGAAGTCCACTATATGGAGAAAAATCCTGGAATGTTTTCCTCAAAAACCTTAATTTCTTTTCGACTGAAGAAAGAAGACATAAACATCTTGGATGACATGGGGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU260696 lncRNA upstream 1660 916116 ~ 916329 (+) True CI01000054_00916253_00919736
TU260679 lncRNA upstream 56769 860600 ~ 861220 (+) True G229717
TU260635 lncRNA upstream 546057 371630 ~ 371932 (+) True G229682
TU260622 lncRNA upstream 569102 302855 ~ 348887 (+) True G229670
TU260590 lncRNA upstream 730961 184874 ~ 187028 (+) True G229638
TU260825 lncRNA downstream 52305 970579 ~ 976960 (+) True G229847
TU260828 lncRNA downstream 60429 978703 ~ 981912 (+) False G229848
TU260830 lncRNA downstream 60429 978703 ~ 980249 (+) True G229848
TU260835 lncRNA downstream 65326 983600 ~ 985153 (+) True G229849
TU260853 lncRNA downstream 92447 1010721 ~ 1011128 (+) True G229864
CI01000054_00885259_00886020.mRNA mRNA upstream 31969 885259 ~ 886020 (+) True CI01000054_00885259_00886020
CI01000054_00879731_00882536.mRNA mRNA upstream 35392 879731 ~ 882597 (+) True CI01000054_00879731_00882536
CI01000054_00869317_00877277.mRNA mRNA upstream 39860 867126 ~ 878129 (+) True CI01000054_00869317_00877277
CI01000054_00666830_00754317.mRNA mRNA upstream 163672 666392 ~ 754317 (+) True CI01000054_00666830_00754317
CI01000054_00637123_00665809.mRNA mRNA upstream 251860 636873 ~ 666129 (+) True CI01000054_00637123_00665809
CI01000054_00992036_01004247.mRNA mRNA downstream 73762 992036 ~ 1004392 (+) True CI01000054_00992036_01004247
CI01000054_01007770_01028369.mRNA mRNA downstream 89378 1007652 ~ 1028832 (+) True CI01000054_01007770_01028369
CI01000054_01042925_01056338.mRNA mRNA downstream 124617 1042891 ~ 1056561 (+) True CI01000054_01042925_01056338
CI01000054_01087465_01101501.mRNA mRNA downstream 168658 1086932 ~ 1101774 (+) True CI01000054_01087465_01101501
CI01000054_01103702_01106852.mRNA mRNA downstream 185167 1103441 ~ 1106852 (+) True CI01000054_01103702_01106852
TU260714 other downstream 308061 1227807 ~ 1227900 (+) True G229740
TU260738 other downstream 348076 1266350 ~ 1273750 (+) True G229760
TU260932 other downstream 478806 1397080 ~ 1407130 (+) False G229936
TU260728 other downstream 660161 1578435 ~ 1582069 (+) True G229750
TU260765 other downstream 732686 1650960 ~ 1661565 (+) True CI01000054_01650242_01665628

Expression Profile


TU260698 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU260698 Expression in each Bioproject

Bar chart with 42 bars.
TU260698 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.