RNA id: TU263141



Basic Information


Item Value
RNA id TU263141
length 233
lncRNA type inter_gene
GC content 0.37
exon number 1
gene id G231883
representative True

Chromosome Information


Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 4393294 ~ 4393526 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome
species grasscarp
(Ctenopharyngodon idella)

Sequence


GGTGTTCTTGCTCTTCGGCTATTTTCAGGCAGTTCAGCTGAAATTATTTGATTTGCATGTTCATATACGCAAATATGCTGTAGGTAAAACAATACATGATGAATGTGAAAACACAATGAAGATGATGTCCAATGTACAATCAAACTCAGCTTGATAGGGTTTACAGAGTGCCTAGAGGAGTGTACATGCCAGCTAAAGAACATAAGTTGGCTATTACAAAAATCTACAGCTAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU263082 lncRNA upstream 110147 4282516 ~ 4283147 (+) True G231832
TU263054 lncRNA upstream 144232 4210022 ~ 4211723 (+) True G231807
TU263061 lncRNA upstream 161701 4224024 ~ 4231593 (+) True G231813
TU263059 lncRNA upstream 176142 4216880 ~ 4217152 (+) True G231811
TU262935 lncRNA upstream 301267 4091604 ~ 4092027 (+) True G231691
TU263142 lncRNA downstream 2495 4396021 ~ 4396286 (+) True G231884
TU263153 lncRNA downstream 81594 4475120 ~ 4475704 (+) True G231895
TU263283 lncRNA downstream 288906 4682432 ~ 4685153 (+) True G232014
TU263313 lncRNA downstream 341871 4735397 ~ 4735780 (+) True G232042
TU263319 lncRNA downstream 366457 4759983 ~ 4760217 (+) True G232048
CI01000054_04372172_04374454.mRNA mRNA upstream 18393 4371425 ~ 4374901 (+) True CI01000054_04372172_04374454
CI01000054_04248925_04249335.mRNA mRNA upstream 143707 4248359 ~ 4249587 (+) False CI01000054_04248925_04249335
CI01000054_03955331_03962388.mRNA mRNA upstream 430899 3955331 ~ 3962395 (+) True CI01000054_03955331_03962388
CI01000054_03848427_03914231.mRNA mRNA upstream 479063 3848427 ~ 3914231 (+) False CI01000054_03848427_03914231
CI01000054_03707961_03761024.mRNA mRNA upstream 632182 3707835 ~ 3761112 (+) True CI01000054_03707961_03761024
CI01000054_04453321_04456780.mRNA mRNA downstream 59795 4453321 ~ 4457108 (+) True CI01000054_04453321_04456780
CI01000054_04658039_04659082.mRNA mRNA downstream 264465 4657991 ~ 4659701 (+) True CI01000054_04658039_04659082
CI01000054_04924205_04945546.mRNA mRNA downstream 530633 4924159 ~ 4945841 (+) True CI01000054_04924205_04945546
CI01000054_04962081_04977729.mRNA mRNA downstream 568404 4961930 ~ 4977937 (+) True CI01000054_04962081_04977729
CI01000054_05145255_05217807.mRNA mRNA downstream 751585 5145111 ~ 5217811 (+) True CI01000054_05145255_05217807
TU262576 other upstream 479748 3908451 ~ 3913546 (+) True CI01000054_03848427_03914231
TU261835 other upstream 1305902 3078502 ~ 3087392 (+) True G230689
TU261855 other upstream 2088912 2289831 ~ 2304382 (+) True CI01000054_02289802_02330591
TU261003 other upstream 2666501 1725669 ~ 1726793 (+) True CI01000054_01725792_01726688
TU260765 other upstream 2731729 1650960 ~ 1661565 (+) True CI01000054_01650242_01665628
TU263121 other downstream 13626 4407152 ~ 4450730 (+) True G231863
TU263797 other downstream 1229489 5623015 ~ 5623101 (+) True G232485
TU263881 other downstream 1600134 5993660 ~ 6041863 (+) True G232558
TU263932 other downstream 1910781 6304307 ~ 6304441 (+) True G232608
TU264006 other downstream 1981324 6374850 ~ 6375894 (+) True G232659

Expression Profile


TU263141 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

TU263141 Expression in each Bioproject

Bar chart with 5 bars.
TU263141 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.