RNA id: TCONS_00016946



Basic Information


Item Value
RNA id TCONS_00016946
length 579
RNA type mRNA
GC content 0.47
exon number 7
gene id XLOC_008464
representative False

Chromosome Information


Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 21252532 ~ 21262567 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CTGGCTGCGGCTACTGTTGTAAACAAGACGCCTCGAGATCAGTAAACGATTTTATAAGACAACAAGAAGTGGTAACACAAATTTTACTTGTTACATACTGACAGTGGAGATGAAAGGACAACCGAAAAGTTCTGAACCTGATGTCAGTGTTCCAGTCATTGAAGAAGGGGCAGTTGCTACTGCAGAAGACCCATCAGCAATCACAACTATTCAATCTGCTTCTACGTTTTCCACGGACCAGCCGATTAAATACCTTTTCAAGACGGAGGGAGCTGGGGGGCAGGTTACATACCGAGTAATCCAGGTTGCAGATGGACAGCTAGAGGCTCAACCTGATGGTACAACAGCTGTTAGTGTAGTGACTGGGTTTCCTGCCACAACACAGCCGGTTACGCAGGCTGTTTTCTCTCAGTCAGAAGGCTTGGAGGGAGATGGCACAGAAACCCATTACACATATTATCCTGCTACTATCTCAGATGCTACTGCAGGCACAATGGTGACAGGTGTTCAGGCCTCAGATGCTCTGCTCAGTCAGAGTGCTTCTGCAGGTCAGTTGTATGTTATGATGTCCCCACAGGA

Function


GO:

id name namespace
GO:0046983 protein dimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1072 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Human ortholog(s) of this gene implicated in cardiovascular system disease and type 2 diabetes mellitus. Orthologous to human USF1 (upstream transcription factor 1).

Ensembl:

ensembl_id ENSDART00000142070

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00018928 lncRNA upstream 1041 21247526 ~ 21251557 (+) False XLOC_008462
TCONS_00018929 lncRNA upstream 1041 21249466 ~ 21251557 (+) True XLOC_008462
TCONS_00018773 lncRNA upstream 6764 21240424 ~ 21245834 (+) True XLOC_008461
TCONS_00018772 lncRNA upstream 88025 21164035 ~ 21164573 (+) True XLOC_008457
TCONS_00018927 lncRNA upstream 214820 21017649 ~ 21037778 (+) True XLOC_008456
TCONS_00016950 lncRNA downstream 11387 21269223 ~ 21272557 (+) True XLOC_008465
TCONS_00018930 lncRNA downstream 65210 21323046 ~ 21427967 (+) False XLOC_008467
TCONS_00018931 lncRNA downstream 65220 21323056 ~ 21495896 (+) False XLOC_008467
TCONS_00018932 lncRNA downstream 65225 21323061 ~ 21390208 (+) False XLOC_008467
TCONS_00018933 lncRNA downstream 65241 21323077 ~ 21390208 (+) False XLOC_008467
TCONS_00016936 mRNA upstream 48127 21202820 ~ 21204471 (+) True XLOC_008460
TCONS_00016930 mRNA upstream 357822 20843161 ~ 20894776 (+) False XLOC_008453
TCONS_00016929 mRNA upstream 443474 20801253 ~ 20809124 (+) True XLOC_008452
TCONS_00016928 mRNA upstream 446403 20799943 ~ 20806195 (+) False XLOC_008452
TCONS_00016924 mRNA upstream 609051 20548212 ~ 20643547 (+) True XLOC_008451
TCONS_00016949 mRNA downstream 5081 21262917 ~ 21275683 (+) False XLOC_008465
TCONS_00016951 mRNA downstream 18899 21276735 ~ 21320638 (+) True XLOC_008466
TCONS_00016956 mRNA downstream 414445 21672281 ~ 21673630 (+) False XLOC_008471
TCONS_00016957 mRNA downstream 414864 21672700 ~ 21673452 (+) True XLOC_008471
TCONS_00016959 mRNA downstream 450064 21707900 ~ 21715436 (+) False XLOC_008472
TCONS_00016937 other upstream 316 21252191 ~ 21252282 (+) True XLOC_008463
TCONS_00016935 other upstream 54312 21180094 ~ 21198286 (+) True XLOC_008459
TCONS_00016934 other upstream 75549 21167142 ~ 21177049 (+) True XLOC_008458
TCONS_00016921 other upstream 717114 20529280 ~ 20535484 (+) False XLOC_008450
TCONS_00016911 other upstream 890626 20355795 ~ 20361972 (+) True XLOC_008446
TCONS_00016953 other downstream 179797 21437633 ~ 21437728 (+) True XLOC_008468
TCONS_00016954 other downstream 180040 21437876 ~ 21437959 (+) True XLOC_008469
TCONS_00016955 other downstream 189820 21447656 ~ 21447800 (+) True XLOC_008467
TCONS_00016960 other downstream 453824 21711660 ~ 21715665 (+) False XLOC_008472
TCONS_00016964 other downstream 509688 21767524 ~ 21770009 (+) True XLOC_008473

Expression Profile


//