RNA id: TCONS_00016992


Basic Information

Item Value
RNA id TCONS_00016992
length 476
lncRNA type retained_intron
GC content 0.43
exon number 3
gene id XLOC_008495
representative False

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 23443665 ~ 23451449 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTCTCCCTTTTCTTTGGTTCAAAGTCTTGCCAGATGTCTTCAGGCTGTAAAAACAGTCGGCTTTAGCAGAAGACCTCGTCGTTTAAAATGGCTGTTGAACTTTTTCACAAAAATGAGACTTTGCAAATGCGCAAGAAGCTGATTGCACAGTCCTGCAGACTCTTTTTCTCCCATGATCCTGTGAAAATAGTCCGAGCACGGGGTCAATATTTATACGACGAGAATGGCACGCAGTATTTAGATTGCATTAGTAATGTTCAACATGTGGGTCACAGTCACCCCAGCATCACTCAGGTGGCTGGCGCTCAGATGGATCTTCTGAACACAAACACTAGATTCCTTCATGATAATATAGTGCAGTATGCTGATCGACTGGCTGCCACTCTCCCAAAGAAACTTTCTGTCTTCTATTTTGTCAACTCAGGGTAAGTGGCTTTTCATTGGGTTTAAAAGCACTGTTCAACAAAATCTTTAAG

Function

GO:

id name namespace
GO:0030170 pyridoxal phosphate binding molecular_function
GO:0008483 transaminase activity molecular_function
GO:0003824 catalytic activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-051127-33 Predicted to enable pyridoxal phosphate binding activity and transaminase activity. Orthologous to human PHYKPL (5-phosphohydroxy-L-lysine phospho-lyase).

Ensembl:

ensembl_id ENSDART00000145359

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00018955 lncRNA upstream 175297 23266658 ~ 23268377 (+) True XLOC_008492
TCONS_00018954 lncRNA upstream 236210 23207159 ~ 23207464 (+) True XLOC_008490
TCONS_00018953 lncRNA upstream 882537 22541364 ~ 22561137 (+) True XLOC_008488
TCONS_00018952 lncRNA upstream 884702 22541364 ~ 22558972 (+) False XLOC_008488
TCONS_00018951 lncRNA upstream 892646 22541344 ~ 22551028 (+) False XLOC_008488
TCONS_00018956 lncRNA downstream 21996 23467984 ~ 23505657 (+) True XLOC_008496
TCONS_00016998 lncRNA downstream 82199 23528187 ~ 23529174 (+) False XLOC_008497
TCONS_00017009 lncRNA downstream 338871 23784859 ~ 23789828 (+) False XLOC_008501
TCONS_00017015 lncRNA downstream 553581 23999569 ~ 24005283 (+) True XLOC_008505
TCONS_00017017 lncRNA downstream 589919 24035907 ~ 24042013 (+) True XLOC_008504
TCONS_00016989 mRNA upstream 84867 23356600 ~ 23358807 (+) True XLOC_008493
TCONS_00016988 mRNA upstream 178269 23208042 ~ 23265405 (+) True XLOC_008491
TCONS_00016985 mRNA upstream 254780 22722684 ~ 23188894 (+) False XLOC_008489
TCONS_00016987 mRNA upstream 256092 22867174 ~ 23187582 (+) True XLOC_008489
TCONS_00016982 mRNA upstream 904831 22448456 ~ 22538843 (+) False XLOC_008487
TCONS_00016995 mRNA downstream 77349 23523337 ~ 23528714 (+) False XLOC_008497
TCONS_00016994 mRNA downstream 77349 23523337 ~ 23528714 (+) False XLOC_008497
TCONS_00016996 mRNA downstream 77357 23523345 ~ 23527716 (+) False XLOC_008497
TCONS_00016997 mRNA downstream 82022 23528010 ~ 23533101 (+) False XLOC_008497
TCONS_00016999 mRNA downstream 82322 23528310 ~ 23532043 (+) False XLOC_008497
TCONS_00016990 other upstream 65486 23378071 ~ 23378188 (+) True XLOC_008494
TCONS_00016984 other upstream 681236 22722682 ~ 22762438 (+) False XLOC_008489
TCONS_00016986 other upstream 710641 22722712 ~ 22733033 (+) False XLOC_008489
TCONS_00016979 other upstream 1029421 22414124 ~ 22414253 (+) True XLOC_008485
TCONS_00016972 other upstream 1440478 22003082 ~ 22003196 (+) True XLOC_008478
TCONS_00016993 other downstream 201 23446189 ~ 23450686 (+) True XLOC_008495
TCONS_00017027 other downstream 1117780 24563768 ~ 24569062 (+) False XLOC_008513
TCONS_00017035 other downstream 1230925 24676913 ~ 24683290 (+) False XLOC_008517
TCONS_00017050 other downstream 1516148 24962136 ~ 24962252 (+) True XLOC_008523
TCONS_00017063 other downstream 2023741 25469729 ~ 25469845 (+) True XLOC_008536

Expression Profile

//