RNA id: TCONS_00017075


Basic Information

Item Value
RNA id TCONS_00017075
length 85
RNA type miRNA
GC content 0.48
exon number 1
gene id XLOC_008543
representative True

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 25896465 ~ 25902650 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTCTCCATGGCGACCGTGGCATTAGATTGTTACTGTAGGAACAGAATTTTTGGTAACAGTCTACAGCCATGGTCGCTAGTGGGCA

Function

GO:

id name namespace
GO:0042737 drug catabolic process biological_process
GO:0019265 glycine biosynthetic process, by transamination of glyoxylate biological_process
GO:0006082 organic acid metabolic process biological_process
GO:0009074 aromatic amino acid family catabolic process biological_process
GO:0017144 drug metabolic process biological_process
GO:0046395 carboxylic acid catabolic process biological_process
GO:0043436 oxoacid metabolic process biological_process
GO:0044281 small molecule metabolic process biological_process
GO:0044282 small molecule catabolic process biological_process
GO:0006570 tyrosine metabolic process biological_process
GO:0006572 tyrosine catabolic process biological_process
GO:0019752 carboxylic acid metabolic process biological_process
GO:0016054 organic acid catabolic process biological_process
GO:0004760 serine-pyruvate transaminase activity molecular_function
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen molecular_function
GO:0004180 carboxypeptidase activity molecular_function
GO:0004497 monooxygenase activity molecular_function
GO:0008453 alanine-glyoxylate transaminase activity molecular_function
GO:0008238 exopeptidase activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000117783

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00018972 lncRNA upstream 327116 25568937 ~ 25570599 (+) True XLOC_008539
TCONS_00017066 lncRNA upstream 368290 25528309 ~ 25529425 (+) True XLOC_008538
TCONS_00018971 lncRNA upstream 498141 25395901 ~ 25399574 (+) True XLOC_008533
TCONS_00018969 lncRNA upstream 520221 25370731 ~ 25377494 (+) False XLOC_008532
TCONS_00018974 lncRNA downstream 778186 26675985 ~ 26680699 (+) True XLOC_008549
TCONS_00017087 lncRNA downstream 1398877 27296676 ~ 27300833 (+) True XLOC_008552
TCONS_00018778 lncRNA downstream 1434058 27331857 ~ 27332639 (+) True XLOC_008553
TCONS_00018975 lncRNA downstream 1812531 27710330 ~ 27712387 (+) False XLOC_008558
TCONS_00018976 lncRNA downstream 1813362 27711161 ~ 27725662 (+) True XLOC_008558
TCONS_00017072 mRNA upstream 207448 25681044 ~ 25690267 (+) False XLOC_008542
TCONS_00017073 mRNA upstream 209247 25683069 ~ 25688468 (+) True XLOC_008542
TCONS_00017068 mRNA upstream 241384 25635326 ~ 25656331 (+) False XLOC_008540
TCONS_00017067 mRNA upstream 241388 25635326 ~ 25656327 (+) False XLOC_008540
TCONS_00017069 mRNA upstream 241388 25635327 ~ 25656327 (+) False XLOC_008540
TCONS_00017077 mRNA downstream 501739 26399538 ~ 26402301 (+) True XLOC_008545
TCONS_00017079 mRNA downstream 675877 26573676 ~ 26593684 (+) False XLOC_008547
TCONS_00017080 mRNA downstream 675951 26573750 ~ 26592561 (+) True XLOC_008547
TCONS_00017081 mRNA downstream 702812 26600611 ~ 26610857 (+) False XLOC_008548
TCONS_00017082 mRNA downstream 705596 26603395 ~ 26610235 (+) True XLOC_008548
TCONS_00017074 other upstream 176 25897446 ~ 25897539 (+) False XLOC_008543
TCONS_00017071 other upstream 230014 25667587 ~ 25667701 (+) True XLOC_008541
TCONS_00017070 other upstream 241384 25635341 ~ 25656331 (+) True XLOC_008540
TCONS_00017063 other upstream 427870 25469729 ~ 25469845 (+) True XLOC_008536
TCONS_00017050 other upstream 935463 24962136 ~ 24962252 (+) True XLOC_008523
TCONS_00017076 other downstream 208516 26106315 ~ 26106433 (+) True XLOC_008544
TCONS_00017078 other downstream 542314 26440113 ~ 26440227 (+) True XLOC_008546
TCONS_00017092 other downstream 1577459 27475258 ~ 27475374 (+) True XLOC_008556
TCONS_00017093 other downstream 1671282 27569081 ~ 27569195 (+) True XLOC_008557
TCONS_00017094 other downstream 1896900 27794699 ~ 27794813 (+) True XLOC_008559