Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU302878

Basic Information

Item	Value
RNA id	TU302878
length	212
lncRNA type	inter_gene
GC content	0.31
exon number	2
gene id	G266846
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000063
NCBI id	null
chromosome length	7808773
location	7688852 ~ 7689102 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

TATTAAGCAGCACAACTGTTTCCAACATTGATAACTGAGTATCAAATTAGCATGTTAGAATGATTTCTGAAGGATCATGTGACACTGAAGACTGGAGAAATGATGCTGAAAATTCAGCTTTGCATCACAGAAATAAATTATATTTTTATGTATATCAAAATAGAAAACTTTTTTCTGTATTTTTGATCAAATGTGCATGTTATGGACTGGGG

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU302690	lncRNA	downstream	96132	7592454 ~ 7592720 (-)	True	G266670
TU302862	lncRNA	downstream	165862	7522718 ~ 7522990 (-)	True	G266833
TU302660	lncRNA	downstream	173157	7511936 ~ 7515695 (-)	True	G266647
TU302856	lncRNA	downstream	207975	7480634 ~ 7480877 (-)	True	G266827
TU302705	lncRNA	downstream	221705	7464469 ~ 7467147 (-)	True	G266685
CI01000063_07678778_07683475.mRNA	mRNA	downstream	5309	7678306 ~ 7683543 (-)	True	CI01000063_07678778_07683475
CI01000063_07653502_07666823.mRNA	mRNA	downstream	21141	7653502 ~ 7667711 (-)	True	CI01000063_07653502_07666823
CI01000063_07619266_07636507.mRNA	mRNA	downstream	51800	7619100 ~ 7637052 (-)	True	CI01000063_07619266_07636507
CI01000063_07605652_07611233.mRNA	mRNA	downstream	77619	7605613 ~ 7611233 (-)	True	CI01000063_07605652_07611233
CI01000063_07578043_07590189.mRNA	mRNA	downstream	98161	7577976 ~ 7590691 (-)	True	CI01000063_07578043_07590189
CI01000063_07790166_07793320.mRNA	mRNA	upstream	100936	7790038 ~ 7795339 (-)	True	CI01000063_07790166_07793320
TU302679	other	downstream	247417	7439085 ~ 7441435 (-)	True	G266660
TU302826	other	downstream	398628	7289728 ~ 7290224 (-)	True	G266797
TU302824	other	downstream	398839	7289495 ~ 7290013 (-)	False	G266797
TU302823	other	downstream	398839	7289728 ~ 7290013 (-)	False	G266797
TU301878	other	downstream	1397906	6288158 ~ 6290946 (-)	True	G265976

Expression Profile